Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0025650.1

Orthogroup ID

OG0014768

Physical Location & Seq

Genomic Coordinates Reverse (-)

3750 .. 6888

Gene Structure 3139 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0025650.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2034 bp

atgagcctacgagaatataggataatgctgcttgttttgaagcaaggctacatcaaaagcgaccacaccaagtataatcagcaacaacaaactctcctcaagatcaaagtgaattatgttcgatctgaggacaatatggcaaacttgctcactaatcgtcagagggagatgcagacattaggggaggtgtctacatgtatggtctcgaaaagtgaaggctcacaacagcctcactctctctaccaaatcagattattgaatgaaaattatattttagtagggaggtttagcccaccaccccaaataaacaaaatcctggcttcatctttgattgatcagtatgtctctctcgtctcgaaaagtatcagaagtaaggacatcaggcttggcagggttttacactcaaacttcatcaaaacagctctcaccctcgacaccttcctgaccaaccggctcattgatctttactccaaatgcaatgccgtacaagatgcccaaaaggctttcgacgaccttccaacgaagaacacccattcttggaacaccatgatatccatgtactcgagaaatggcagttttgacaatgcacgccatttgcttgctaaaatgacagaaccaaatcttgtgagctataatactttggtttctggtttagcacgtcatgggtatcataaagaatccatatctctcttccaagggatgcaacaggattgtgaatgtttattcttggaccagttcacgtttgtaagcatagtggggacttgtgcttgcttaggtgcattggcaatgttgcgtcaagttcatggggtggcgattgcaattggcttggaaatgaatatcattgcttgcaattctttggtcaatgcttatggaaaatgtggtgaaccagacacctcatattctgtcttcagtcgaatgctagagagggacgttgtgtcttggacctcaatgattgcttcttatgcacgggcatcaagaatggatgacgcttgttgggtatttcatggtatgcctcttaagaacacagtttcttggactgctttgatttcgggttttgtacaaagtgggcatggtaattatgctttggatcttttccagaaaatgctgggagagaggatccggcctagcacagttacatatgttagcattttgagtgcttgtgcagatctagcacttaatgaaagaggtaagcagattcatgggcatatcattagaagtaataatggaagctacttgtccaatgtatttatttgtaatgctctagttgacatgtacagcaaatgtggggacatgaaatcgggaaaaacattgtttgagatgattcctgagaaggatgtaatctcttggaactctttaattactggatttgctcagaatgggctggggaaggagtcacttcttgtttttaagaggatggtagaaacaaatgtgaagcctactcatgtgacttttcttttggtgttatctgcttgtagccacacgggtttagtttctgaaggacttcaaattctgcacttaatggaaaagggttatggtattaaacctagatcaagtcactatgcaattgtgattgatttgctcgggaggaaaaataaactgaaggaagcgatggagttgattgagagagctcctcatgcatcagatcatatagggatgtggggtgcacttttggctgcttgtcgagtccatgggaacttggccctagctaggagggctgcagaagctctttttgagttggagccccacaatggtgcaaggtatgttatgttatcaaacatttatgccgcagctggtagatgggctgatgcccataaggtgagaaggctcatggaagaaagaggtttgacaaaagagtcagcttatagtttgatagagctgagaaatgcaaggcatgagtttgtagcaaaagacaaggtccactgtcagacaggagagatgaatgatacgattggtaaattagcagaccatatgaaggatgtaggcaaccttccttacatttacagccttttgtccgaggataatggttattcctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR

Protein Analysis

677

Amino Acids

75.9

Weight (kDa)

8.89

Isoelectric Point (pI)

36.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014768)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g25010 FvH4_6g25010 FvH4_6g25010 FvH4_6g25010 FvH4_6g25010 FvH4_6g25010 FvH4_6g25010 FvH4_6g25010
rosa_chinensis	RchiOBHm_Chr2g0124721
rosa_laevigata	RLG00000018817
rosa_multiflora	Rmu_sc0025650.1_g000001
rosa_roxburghii	Rroxscaffold_2G00119700
rosa_rugosa	Rorug02G0252100 Rorug02G0252100
rosa_samantha	Rh2CG298500 Rh2DG335200
rosa_wichuraiana	Rw2G025170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1852
AccI	GTMKAC	1 cut(s)	191
AciI	CCGC	1 cut(s)	1785
AclWI	GGATC	3 cut(s)	1095, 1111, 1124
AcsI	RAATTY	1 cut(s)	1506
AcuI	CTGAAG	3 cut(s)	892, 1515, 1619
AfaI	GTAC	4 cut(s)	486, 560, 1059, 1274
AfiI	CCNNNNNNNGG	4 cut(s)	537, 1707, 1748, 1972
AflII	CTTAAG	1 cut(s)	1016
AflIII	ACRYGT	2 cut(s)	194, 1269
AgsI	TTSAA	3 cut(s)	40, 259, 1505
AhdI	GACNNNNNGTC	1 cut(s)	934
AjiI	CACGTC	1 cut(s)	659
AjnI	CCWGG	1 cut(s)	315
AleI	CACNNNNGTG	1 cut(s)	1749
AluBI	AGCT	9 cut(s)	422, 630, 1230, 1628, 1706, 1724, 1790, 1859, 1876
AluI	AGCT	9 cut(s)	422, 630, 1230, 1628, 1706, 1724, 1790, 1859, 1876
Alw21I	GWGCWC	2 cut(s)	1630, 1666
Alw26I	GTCTC	3 cut(s)	208, 349, 358
Alw44I	GTGCAC	1 cut(s)	1662
AlwI	GGATC	3 cut(s)	1095, 1111, 1124
Ama87I	CYCGRG	2 cut(s)	562, 1580
AoxI	GGCC	2 cut(s)	1121, 1698
ApaLI	GTGCAC	1 cut(s)	1662
ApeKI	GCWGC	4 cut(s)	28, 1673, 1715, 1787
ApoI	RAATTY	1 cut(s)	1506
ArsI	GACNNNNNNTTYG	2 cut(s)	1438, 1470
Asp700I	GAANNNNTTC	1 cut(s)	1500
AspS9I	GGNCC	4 cut(s)	730, 942, 1699, 1915
AsuHPI	GGTGA	3 cut(s)	418, 893, 1828
AvaI	CYCGRG	2 cut(s)	562, 1580
AvaII	GGWCC	3 cut(s)	730, 942, 1915
BaeGI	GKGCMC	1 cut(s)	1666
BamHI	GGATCC	1 cut(s)	1116
BanII	GRGCYC	2 cut(s)	1630, 1743
BarI	GAAGNNNNNNTAC	4 cut(s)	32, 64, 1971, 2003
BbsI	GAAGAC	1 cut(s)	898
Bbv12I	GWGCWC	2 cut(s)	1630, 1666
BbvI	GCAGC	4 cut(s)	15, 1660, 1702, 1799
BccI	CCATC	3 cut(s)	1408, 1603, 1791
BceAI	ACGGC	1 cut(s)	467
BciT130I	CCWGG	1 cut(s)	317
BclI	TGATCA	1 cut(s)	334
BcoDI	GTCTC	3 cut(s)	208, 349, 358
BfaI	CTAG	7 cut(s)	920, 1125, 1169, 1262, 1545, 1703, 1707
BfmI	CTRYAG	1 cut(s)	1716
BfrI	CTTAAG	1 cut(s)	1016
BglI	GCCNNNNNGGC	1 cut(s)	500
BglII	AGATCT	1 cut(s)	1165
BisI	GCNGC	5 cut(s)	29, 1674, 1716, 1785, 1788
BlsI	GCNGC	5 cut(s)	30, 1675, 1717, 1786, 1789
Bme1390I	CCNGG	1 cut(s)	317
Bme18I	GGWCC	3 cut(s)	730, 942, 1915
BmeRI	GACNNNNNGTC	1 cut(s)	934
BmeT110I	CYCGRG	2 cut(s)	562, 1580
BmgBI	CACGTC	1 cut(s)	659
BmgT120I	GGNCC	4 cut(s)	730, 942, 1699, 1915
BmiI	GGNNCC	2 cut(s)	1118, 1740
BmrFI	CCNGG	1 cut(s)	317
BmsI	GCATC	6 cut(s)	159, 481, 690, 980, 1646, 1795
BpiI	GAAGAC	1 cut(s)	898
BplI	GAGNNNNNCTC	2 cut(s)	1615, 1647
Bpu10I	CCTNAGC	1 cut(s)	772
BpuEI	CTTGAG	1 cut(s)	83
BsaI	GGTCTC	1 cut(s)	208
BsaJI	CCNNGG	3 cut(s)	694, 1687, 2013
BsaXI	ACNNNNNCTCC	2 cut(s)	78, 108
Bsc4I	CCNNNNNNNGG	4 cut(s)	537, 1707, 1748, 1972
Bse118I	RCCGGY	1 cut(s)	450
Bse1I	ACTGG	2 cut(s)	733, 1366
Bse3DI	GCAATG	3 cut(s)	484, 792, 840
BseBI	CCWGG	1 cut(s)	317
BseDI	CCNNGG	3 cut(s)	694, 1687, 2013
BseGI	GGATG	6 cut(s)	705, 988, 1339, 1419, 1659, 1981
BseLI	CCNNNNNNNGG	4 cut(s)	537, 1707, 1748, 1972
BseMI	GCAATG	3 cut(s)	484, 792, 840
BseMII	CTCAG	4 cut(s)	117, 1317, 1385, 1868
BseNI	ACTGG	2 cut(s)	733, 1366
BseRI	GAGGAG	2 cut(s)	86, 1620
BseSI	GKGCMC	1 cut(s)	1666
BseXI	GCAGC	4 cut(s)	15, 1660, 1702, 1799
BseYI	CCCAGC	2 cut(s)	1105, 1381
BsgI	GTGCAG	2 cut(s)	1182, 1496
BshFI	GGCC	2 cut(s)	1123, 1700
BsiHKAI	GWGCWC	2 cut(s)	1630, 1666
BsiHKCI	CYCGRG	2 cut(s)	562, 1580
BsiSI	CCGG	2 cut(s)	451, 1120
BslFI	GGGAC	3 cut(s)	772, 941, 1301
BslI	CCNNNNNNNGG	4 cut(s)	537, 1707, 1748, 1972
BsmAI	GTCTC	3 cut(s)	208, 349, 358
BsmBI	CGTCTC	1 cut(s)	358
BsmFI	GGGAC	3 cut(s)	772, 941, 1301
BsmI	GAATGC	1 cut(s)	921
BsnI	GGCC	2 cut(s)	1123, 1700
Bso31I	GGTCTC	1 cut(s)	208
BsoBI	CYCGRG	2 cut(s)	562, 1580
Bsp1286I	GDGCHC	3 cut(s)	1630, 1666, 1743
Bsp1407I	TGTACA	2 cut(s)	1057, 1272
Bsp143I	GATC	9 cut(s)	102, 122, 334, 460, 1087, 1116, 1165, 1547, 1642
Bsp19I	CCATGG	1 cut(s)	1687
BspACI	CCGC	1 cut(s)	1785
BspANI	GGCC	2 cut(s)	1123, 1700
BspCNI	CTCAG	4 cut(s)	118, 1318, 1384, 1869
BspLI	GGNNCC	2 cut(s)	1118, 1740
BspMAI	CTGCAG	1 cut(s)	1720
BspPI	GGATC	3 cut(s)	1095, 1111, 1124
BspTI	CTTAAG	1 cut(s)	1016
BspTNI	GGTCTC	1 cut(s)	208
BsrDI	GCAATG	3 cut(s)	484, 792, 840
BsrFI	RCCGGY	1 cut(s)	450
BsrGI	TGTACA	2 cut(s)	1057, 1272
BsrI	ACTGG	2 cut(s)	733, 1366
BssAI	RCCGGY	1 cut(s)	450
BssECI	CCNNGG	3 cut(s)	694, 1687, 2013
BssMI	GATC	9 cut(s)	102, 122, 334, 460, 1087, 1116, 1165, 1547, 1642
BssT1I	CCWWGG	2 cut(s)	694, 1687
Bst2UI	CCWGG	1 cut(s)	317
Bst4CI	ACNGT	3 cut(s)	1027, 1132, 1922
Bst6I	CTCTTC	1 cut(s)	695
BstAFI	CTTAAG	1 cut(s)	1016
BstAUI	TGTACA	2 cut(s)	1057, 1272
BstC8I	GCNNGC	4 cut(s)	589, 600, 769, 847
BstDEI	CTNAG	5 cut(s)	126, 772, 1326, 1371, 1877
BstDSI	CCRYGG	1 cut(s)	1687
BstF5I	GGATG	6 cut(s)	705, 988, 1339, 1419, 1659, 1981
BstKTI	GATC	9 cut(s)	105, 125, 337, 463, 1090, 1119, 1168, 1550, 1645
BstMAI	GTCTC	3 cut(s)	208, 349, 358
BstMBI	GATC	9 cut(s)	102, 122, 334, 460, 1087, 1116, 1165, 1547, 1642
BstMWI	GCNNNNNNNGC	7 cut(s)	500, 962, 1169, 1634, 1670, 1712, 1721
BstNI	CCWGG	1 cut(s)	317
BstNSI	RCATGY	2 cut(s)	198, 1273
BstSCI	CCNGG	1 cut(s)	315
BstSFI	CTRYAG	1 cut(s)	1716
BstSLI	GKGCMC	1 cut(s)	1666
BstV1I	GCAGC	4 cut(s)	15, 1660, 1702, 1799
BstV2I	GAAGAC	1 cut(s)	898
BstX2I	RGATCY	3 cut(s)	1087, 1116, 1165
BstYI	RGATCY	3 cut(s)	1087, 1116, 1165
BsuRI	GGCC	2 cut(s)	1123, 1700
BtgI	CCRYGG	1 cut(s)	1687
BtgZI	GCGATG	1 cut(s)	1622
BtrI	CACGTC	1 cut(s)	659
BtsCI	GGATG	6 cut(s)	705, 988, 1339, 1419, 1659, 1981
BtsIMutI	CAGTG	1 cut(s)	1918
Cac8I	GCNNGC	4 cut(s)	589, 600, 769, 847
Cfr10I	RCCGGY	1 cut(s)	450
Cfr13I	GGNCC	4 cut(s)	730, 942, 1699, 1915
CseI	GACGC	2 cut(s)	782, 995
Csp6I	GTAC	4 cut(s)	485, 559, 1058, 1273
CviQI	GTAC	4 cut(s)	485, 559, 1058, 1273
DdeI	CTNAG	5 cut(s)	126, 772, 1326, 1371, 1877
DpnI	GATC	9 cut(s)	104, 124, 336, 462, 1089, 1118, 1167, 1549, 1644
DpnII	GATC	9 cut(s)	102, 122, 334, 460, 1087, 1116, 1165, 1547, 1642
DrdI	GACNNNNNNGTC	1 cut(s)	1852
DriI	GACNNNNNGTC	1 cut(s)	934
DseDI	GACNNNNNNGTC	1 cut(s)	1852
Eam1104I	CTCTTC	1 cut(s)	695
Eam1105I	GACNNNNNGTC	1 cut(s)	934
EarI	CTCTTC	1 cut(s)	695
Ecl136II	GAGCTC	1 cut(s)	1628
Eco130I	CCWWGG	2 cut(s)	694, 1687
Eco24I	GRGCYC	2 cut(s)	1630, 1743
Eco31I	GGTCTC	1 cut(s)	208
Eco32I	GATATC	1 cut(s)	552
Eco47I	GGWCC	3 cut(s)	730, 942, 1915
Eco53kI	GAGCTC	1 cut(s)	1628
Eco57I	CTGAAG	3 cut(s)	892, 1515, 1619
Eco88I	CYCGRG	2 cut(s)	562, 1580
EcoICRI	GAGCTC	1 cut(s)	1628
EcoRII	CCWGG	1 cut(s)	315
EcoRV	GATATC	1 cut(s)	552
EcoT14I	CCWWGG	2 cut(s)	694, 1687
EcoT22I	ATGCAT	1 cut(s)	1639
EcoT38I	GRGCYC	2 cut(s)	1630, 1743
ErhI	CCWWGG	2 cut(s)	694, 1687
Esp3I	CGTCTC	1 cut(s)	358
FaqI	GGGAC	3 cut(s)	772, 941, 1301
FauNDI	CATATG	2 cut(s)	1138, 1968
FbaI	TGATCA	1 cut(s)	334
FblI	GTMKAC	1 cut(s)	191
Fnu4HI	GCNGC	5 cut(s)	29, 1674, 1716, 1785, 1788
FokI	GGATG	6 cut(s)	712, 995, 1346, 1426, 1666, 1988
FriOI	GRGCYC	2 cut(s)	1630, 1743
Fsp4HI	GCNGC	5 cut(s)	29, 1674, 1716, 1785, 1788
FspBI	CTAG	7 cut(s)	920, 1125, 1169, 1262, 1545, 1703, 1707
GluI	GCNGC	5 cut(s)	29, 1674, 1716, 1785, 1788
GsaI	CCCAGC	2 cut(s)	1109, 1385
HaeIII	GGCC	2 cut(s)	1123, 1700
HapII	CCGG	2 cut(s)	451, 1120
HgaI	GACGC	2 cut(s)	782, 995
HincII	GTYRAC	1 cut(s)	1267
HindII	GTYRAC	1 cut(s)	1267
HinfI	GANTC	6 cut(s)	677, 1195, 1321, 1391, 1683, 1853
HpaII	CCGG	2 cut(s)	451, 1120
HphI	GGTGA	3 cut(s)	418, 893, 1828
Hpy166II	GTNNAC	6 cut(s)	192, 738, 884, 1267, 1664, 1918
Hpy188I	TCNGA	9 cut(s)	127, 162, 251, 368, 1374, 1495, 1642, 1926, 2014
Hpy8I	GTNNAC	6 cut(s)	192, 738, 884, 1267, 1664, 1918
Hpy99I	CGWCG	1 cut(s)	512
HpyCH4III	ACNGT	3 cut(s)	1027, 1132, 1922
HpyCH4IV	ACGT	3 cut(s)	658, 740, 930
HpyF10VI	GCNNNNNNNGC	7 cut(s)	500, 962, 1169, 1634, 1670, 1712, 1721
HpyF3I	CTNAG	5 cut(s)	126, 772, 1326, 1371, 1877
HpySE526I	ACGT	3 cut(s)	658, 740, 930
Ksp22I	TGATCA	1 cut(s)	334
Kzo9I	GATC	9 cut(s)	102, 122, 334, 460, 1087, 1116, 1165, 1547, 1642
LmnI	GCTCC	2 cut(s)	1633, 1738
Lsp1109I	GCAGC	4 cut(s)	15, 1660, 1702, 1799
LweI	GCATC	6 cut(s)	159, 481, 690, 980, 1646, 1795
MaeI	CTAG	7 cut(s)	920, 1125, 1169, 1262, 1545, 1703, 1707
MaeII	ACGT	3 cut(s)	658, 740, 930
MaeIII	GTNAC	4 cut(s)	1132, 1392, 1444, 1553
MalI	GATC	9 cut(s)	104, 124, 336, 462, 1089, 1118, 1167, 1549, 1644
MboI	GATC	9 cut(s)	102, 122, 334, 460, 1087, 1116, 1165, 1547, 1642
MboII	GAAGA	4 cut(s)	535, 682, 898, 1844
MfeI	CAATTG	2 cut(s)	819, 1563
MflI	RGATCY	3 cut(s)	1087, 1116, 1165
MhlI	GDGCHC	3 cut(s)	1630, 1666, 1743
MluCI	AATT	9 cut(s)	112, 265, 819, 850, 1075, 1356, 1506, 1563, 1955
MlyI	GAGTC	3 cut(s)	1400, 1692, 1862
MmeI	TCCRAC	2 cut(s)	542, 1716
Mph1103I	ATGCAT	1 cut(s)	1639
MroXI	GAANNNNTTC	1 cut(s)	1500
MseI	TTAA	6 cut(s)	1017, 1176, 1355, 1407, 1517, 1539
MslI	CAYNNNNRTG	1 cut(s)	1749
MspA1I	CMGCKG	1 cut(s)	1790
MspCI	CTTAAG	1 cut(s)	1016
MspI	CCGG	2 cut(s)	451, 1120
MspR9I	CCNGG	1 cut(s)	317
MunI	CAATTG	2 cut(s)	819, 1563
Mva1269I	GAATGC	1 cut(s)	921
MvaI	CCWGG	1 cut(s)	317
MwoI	GCNNNNNNNGC	7 cut(s)	500, 962, 1169, 1634, 1670, 1712, 1721
NcoI	CCATGG	1 cut(s)	1687
NdeI	CATATG	2 cut(s)	1138, 1968
NdeII	GATC	9 cut(s)	102, 122, 334, 460, 1087, 1116, 1165, 1547, 1642
NlaIV	GGNNCC	2 cut(s)	1118, 1740
NmuCI	GTSAC	3 cut(s)	1392, 1444, 1553
NsiI	ATGCAT	1 cut(s)	1639
NspI	RCATGY	2 cut(s)	198, 1273
OliI	CACNNNNGTG	1 cut(s)	1749
PaeR7I	CTCGAG	1 cut(s)	562
PciI	ACATGT	2 cut(s)	194, 1269
PctI	GAATGC	1 cut(s)	921
PdmI	GAANNNNTTC	1 cut(s)	1500
PfeI	GAWTC	3 cut(s)	677, 1195, 1321
PflFI	GACNNNGTC	1 cut(s)	1913
PkrI	GCNGC	5 cut(s)	30, 1675, 1717, 1786, 1789
PleI	GAGTC	3 cut(s)	1399, 1691, 1861
PpsI	GAGTC	3 cut(s)	1399, 1691, 1861
PscI	ACATGT	2 cut(s)	194, 1269
Psp124BI	GAGCTC	1 cut(s)	1630
Psp6I	CCWGG	1 cut(s)	315
PspFI	CCCAGC	2 cut(s)	1105, 1381
PspGI	CCWGG	1 cut(s)	315
PspN4I	GGNNCC	2 cut(s)	1118, 1740
PspPI	GGNCC	4 cut(s)	730, 942, 1699, 1915
PstI	CTGCAG	1 cut(s)	1720
PsuI	RGATCY	3 cut(s)	1087, 1116, 1165
PsyI	GACNNNGTC	1 cut(s)	1913
PvuII	CAGCTG	1 cut(s)	1790
RsaI	GTAC	4 cut(s)	486, 560, 1059, 1274
RsaNI	GTAC	4 cut(s)	485, 559, 1058, 1273
RseI	CAYNNNNRTG	1 cut(s)	1749
SacI	GAGCTC	1 cut(s)	1630
SaqAI	TTAA	6 cut(s)	1017, 1176, 1355, 1407, 1517, 1539
SatI	GCNGC	5 cut(s)	29, 1674, 1716, 1785, 1788
Sau3AI	GATC	9 cut(s)	102, 122, 334, 460, 1087, 1116, 1165, 1547, 1642
Sau96I	GGNCC	4 cut(s)	730, 942, 1699, 1915
SchI	GAGTC	3 cut(s)	1400, 1692, 1862
ScrFI	CCNGG	1 cut(s)	317
SduI	GDGCHC	3 cut(s)	1630, 1666, 1743
SfaNI	GCATC	6 cut(s)	159, 481, 690, 980, 1646, 1795
SfcI	CTRYAG	1 cut(s)	1716
Sfr274I	CTCGAG	1 cut(s)	562
SinI	GGWCC	3 cut(s)	730, 942, 1915
SlaI	CTCGAG	1 cut(s)	562
SmiMI	CAYNNNNRTG	1 cut(s)	1749
SmlI	CTYRAG	3 cut(s)	98, 562, 1016
SmoI	CTYRAG	3 cut(s)	98, 562, 1016
Sse9I	AATT	9 cut(s)	112, 265, 819, 850, 1075, 1356, 1506, 1563, 1955
SsiI	CCGC	1 cut(s)	1785
SspMI	CTAG	7 cut(s)	920, 1125, 1169, 1262, 1545, 1703, 1707
SstI	GAGCTC	1 cut(s)	1630
StyD4I	CCNGG	1 cut(s)	315
StyI	CCWWGG	2 cut(s)	694, 1687
TaaI	ACNGT	3 cut(s)	1027, 1132, 1922
TaiI	ACGT	3 cut(s)	661, 743, 933
TaqI	TCGA	8 cut(s)	121, 206, 356, 432, 507, 563, 913, 1681
TasI	AATT	9 cut(s)	112, 265, 819, 850, 1075, 1356, 1506, 1563, 1955
TatI	WGTACW	3 cut(s)	558, 1057, 1272
TauI	GCSGC	1 cut(s)	1787
TfiI	GAWTC	3 cut(s)	677, 1195, 1321
Tru1I	TTAA	6 cut(s)	1017, 1176, 1355, 1407, 1517, 1539
Tru9I	TTAA	6 cut(s)	1017, 1176, 1355, 1407, 1517, 1539
TscAI	CASTG	1 cut(s)	1925
TseFI	GTSAC	3 cut(s)	1392, 1444, 1553
TseI	GCWGC	4 cut(s)	28, 1673, 1715, 1787
Tsp45I	GTSAC	3 cut(s)	1392, 1444, 1553
TspRI	CASTG	1 cut(s)	1925
Tth111I	GACNNNGTC	1 cut(s)	1913
Vha464I	CTTAAG	1 cut(s)	1016
VneI	GTGCAC	1 cut(s)	1662
VpaK11BI	GGWCC	3 cut(s)	730, 942, 1915
XapI	RAATTY	1 cut(s)	1506
XceI	RCATGY	2 cut(s)	198, 1273
XhoI	CTCGAG	1 cut(s)	562
XmiI	GTMKAC	1 cut(s)	191
XmnI	GAANNNNTTC	1 cut(s)	1500
XspI	CTAG	7 cut(s)	920, 1125, 1169, 1262, 1545, 1703, 1707
Zsp2I	ATGCAT	1 cut(s)	1639

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.