Rmu_sc0028140.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028140.1
Physical Location & Seq
Forward (+)
1 .. 376
376 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028140.1_g000001.1.cds

Sequence Viewer

Length: 230 bp
ggaggagaggaagaatgaaggagaggaggaatgtgaatgcaatgagatcggcggtggtggtgctcggagcattggcatttgggtacctaactctgcagctaggattcaagccatatcttgaaagagcccaaattgctgctgaccaatctgagctctcttcttcctcagagcaactacaacaagaacaagaacaagaacaacccaactcgagctcaactcgccatttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.49

Weight (kDa)

9.51

Isoelectric Point (pI)

82.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016523)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G63160 AT5G19151
fragaria_vesca FvH4_4g14770
malus_domestica MD13G1185300.v1.1
prunus_persica Prupe.1G152900_v2.0.a1
rosa_chinensis RchiOBHm_Chr0c32g0501461 RchiOBHm_Chr0c32g0501651
rosa_laevigata RLG00000007896 RLG00000023258
rosa_multiflora Rmu_sc0021105.1_g000001 Rmu_sc0028140.1_g000001
rosa_roxburghii Rroxscaffold_6G00398110
rosa_samantha Rh4DG209700
rosa_wichuraiana Rw4G017960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 83
AccB1I GGYRCC 1 cut(s) 83
AciI CCGC 1 cut(s) 52
AfaI GTAC 1 cut(s) 85
AgsI TTSAA 2 cut(s) 108, 121
AluBI AGCT 3 cut(s) 99, 153, 212
AluI AGCT 3 cut(s) 99, 153, 212
Alw21I GWGCWC 3 cut(s) 65, 155, 214
Ama87I CYCGRG 1 cut(s) 207
ApeKI GCWGC 2 cut(s) 96, 136
Asp718I GGTACC 1 cut(s) 83
AvaI CYCGRG 1 cut(s) 207
BanI GGYRCC 1 cut(s) 83
BanII GRGCYC 3 cut(s) 129, 155, 214
Bbv12I GWGCWC 3 cut(s) 65, 155, 214
BbvI GCAGC 2 cut(s) 108, 123
BcgI CGANNNNNNTGC 2 cut(s) 29, 63
BfaI CTAG 1 cut(s) 100
BfmI CTRYAG 1 cut(s) 94
BisI GCNGC 2 cut(s) 97, 137
BlsI GCNGC 2 cut(s) 98, 138
BmeT110I CYCGRG 1 cut(s) 207
BmiI GGNNCC 1 cut(s) 85
BplI GAGNNNNNCTC 1 cut(s) 201
Bse3DI GCAATG 1 cut(s) 47
BseMI GCAATG 1 cut(s) 47
BseMII CTCAG 2 cut(s) 140, 179
BseRI GAGGAG 2 cut(s) 18, 39
BseXI GCAGC 2 cut(s) 108, 123
BshNI GGYRCC 1 cut(s) 83
BsiHKAI GWGCWC 3 cut(s) 65, 155, 214
BsiHKCI CYCGRG 1 cut(s) 207
BsmI GAATGC 1 cut(s) 42
BsoBI CYCGRG 1 cut(s) 207
Bsp1286I GDGCHC 4 cut(s) 65, 129, 155, 214
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 1 cut(s) 52
BspCNI CTCAG 2 cut(s) 141, 178
BspLI GGNNCC 1 cut(s) 85
BspMAI CTGCAG 1 cut(s) 98
BspT107I GGYRCC 1 cut(s) 83
BsrDI GCAATG 1 cut(s) 47
BssMI GATC 1 cut(s) 46
Bst6I CTCTTC 1 cut(s) 162
BstDEI CTNAG 2 cut(s) 149, 165
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstMWI GCNNNNNNNGC 2 cut(s) 133, 218
BstSFI CTRYAG 1 cut(s) 94
BstV1I GCAGC 2 cut(s) 108, 123
Csp6I GTAC 1 cut(s) 84
CviJI RGCY 5 cut(s) 99, 111, 127, 153, 212
CviKI_1 RGCY 5 cut(s) 99, 111, 127, 153, 212
CviQI GTAC 1 cut(s) 84
DdeI CTNAG 2 cut(s) 149, 165
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eam1104I CTCTTC 1 cut(s) 162
EarI CTCTTC 1 cut(s) 162
Ecl136II GAGCTC 2 cut(s) 153, 212
Eco24I GRGCYC 3 cut(s) 129, 155, 214
Eco53kI GAGCTC 2 cut(s) 153, 212
Eco88I CYCGRG 1 cut(s) 207
EcoICRI GAGCTC 2 cut(s) 153, 212
EcoT38I GRGCYC 3 cut(s) 129, 155, 214
FaiI YATR 1 cut(s) 114
Fnu4HI GCNGC 2 cut(s) 97, 137
FriOI GRGCYC 3 cut(s) 129, 155, 214
Fsp4HI GCNGC 2 cut(s) 97, 137
FspBI CTAG 1 cut(s) 100
GluI GCNGC 2 cut(s) 97, 137
HinfI GANTC 1 cut(s) 104
Hpy188I TCNGA 3 cut(s) 67, 150, 168
Hpy188III TCNNGA 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 12
HpyCH4V TGCA 2 cut(s) 40, 96
HpyF10VI GCNNNNNNNGC 2 cut(s) 133, 218
HpyF3I CTNAG 2 cut(s) 149, 165
KpnI GGTACC 1 cut(s) 87
Kzo9I GATC 1 cut(s) 46
LmnI GCTCC 1 cut(s) 67
Lsp1109I GCAGC 2 cut(s) 108, 123
MaeI CTAG 1 cut(s) 100
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 3 cut(s) 23, 149, 152
MhlI GDGCHC 4 cut(s) 65, 129, 155, 214
MluCI AATT 1 cut(s) 131
MnlI CCTC 3 cut(s) 17, 20, 174
Mva1269I GAATGC 1 cut(s) 42
MwoI GCNNNNNNNGC 2 cut(s) 133, 218
NdeII GATC 1 cut(s) 46
NlaIV GGNNCC 1 cut(s) 85
PaeR7I CTCGAG 1 cut(s) 207
PctI GAATGC 1 cut(s) 42
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 2 cut(s) 98, 138
Psp124BI GAGCTC 2 cut(s) 155, 214
PspN4I GGNNCC 1 cut(s) 85
PspXI VCTCGAGB 1 cut(s) 207
PstI CTGCAG 1 cut(s) 98
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
SacI GAGCTC 2 cut(s) 155, 214
SatI GCNGC 2 cut(s) 97, 137
Sau3AI GATC 1 cut(s) 46
SduI GDGCHC 4 cut(s) 65, 129, 155, 214
SetI ASST 4 cut(s) 89, 101, 155, 214
SfcI CTRYAG 1 cut(s) 94
Sfr274I CTCGAG 1 cut(s) 207
SgeI CNNG 9 cut(s) 76, 112, 120, 130, 193, 199, 205, 219, 221
SlaI CTCGAG 1 cut(s) 207
SmlI CTYRAG 1 cut(s) 207
SmoI CTYRAG 1 cut(s) 207
Sse9I AATT 1 cut(s) 131
SsiI CCGC 1 cut(s) 52
SspMI CTAG 1 cut(s) 100
SstI GAGCTC 2 cut(s) 155, 214
TaqI TCGA 1 cut(s) 208
TasI AATT 1 cut(s) 131
TfiI GAWTC 1 cut(s) 104
TseI GCWGC 2 cut(s) 96, 136
TspDTI ATGAA 1 cut(s) 31
XhoI CTCGAG 1 cut(s) 207
XspI CTAG 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.