Rmu_sc0029164.1_g000001

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0029164.1
Physical Location & Seq
Reverse (-)
2 .. 587
586 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0029164.1_g000001.1.cds

Sequence Viewer

Length: 449 bp
atgattgactacttgttcacattgcataggcttgatctctacagaagcaagttttctggcattcctgtatgcgtcagcaacctcgtgaatttgacaaaactcgacttacatggttgtatacagcttaaagaaattccagaacttccgtcaagcgtaaaatgggttgatgtcgctggttgcaggtcattgaccagatttcgacaattgtatgatatacccggtggaattgagtggttcaacttgtgtgaatctggactatggaatgataatgataaacaagattgtatggaatcaggaagtgaagttcccaagtggttcggttacactgtgattccagatcatttccctacccttccattttaccgcccctctgaatacccagttcccatatgtgagcatgcaattgaaattcctgcacaattcaaatgggagaacaccggagtggcttt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

149

Amino Acids

17.15

Weight (kDa)

5.12

Isoelectric Point (pI)

46.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019807)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 171
AccI GTMKAC 1 cut(s) 118
AciI CCGC 1 cut(s) 364
AcsI RAATTY 3 cut(s) 88, 132, 408
AgsI TTSAA 3 cut(s) 238, 407, 424
AleI CACNNNNGTG 1 cut(s) 440
AloI GAACNNNNNNTCC 2 cut(s) 288, 320
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
ApoI RAATTY 3 cut(s) 88, 132, 408
AsuC2I CCSGG 1 cut(s) 219
BauI CACGAG 1 cut(s) 83
BcnI CCSGG 1 cut(s) 219
BfmI CTRYAG 1 cut(s) 40
BfuAI ACCTGC 1 cut(s) 171
Bme1390I CCNGG 1 cut(s) 219
BmrFI CCNGG 1 cut(s) 219
BmrI ACTGGG 1 cut(s) 374
BmuI ACTGGG 1 cut(s) 374
BpuMI CCSGG 1 cut(s) 219
BsaWI WCCGGW 1 cut(s) 437
Bse1I ACTGG 1 cut(s) 380
Bse3DI GCAATG 1 cut(s) 20
BseMI GCAATG 1 cut(s) 20
BseNI ACTGG 1 cut(s) 380
BsgI GTGCAG 1 cut(s) 399
BsiSI CCGG 2 cut(s) 219, 438
BsmI GAATGC 1 cut(s) 60
Bsp143I GATC 2 cut(s) 34, 337
BspACI CCGC 1 cut(s) 364
BspMI ACCTGC 1 cut(s) 171
BsrDI GCAATG 1 cut(s) 20
BsrI ACTGG 1 cut(s) 380
BssMI GATC 2 cut(s) 34, 337
BssNAI GTATAC 1 cut(s) 119
BssSI CACGAG 1 cut(s) 83
Bst1107I GTATAC 1 cut(s) 119
Bst2BI CACGAG 1 cut(s) 83
Bst4CI ACNGT 1 cut(s) 328
BstC8I GCNNGC 1 cut(s) 399
BstKTI GATC 2 cut(s) 37, 340
BstMBI GATC 2 cut(s) 34, 337
BstNSI RCATGY 1 cut(s) 401
BstSCI CCNGG 1 cut(s) 217
BstSFI CTRYAG 1 cut(s) 40
BstZ17I GTATAC 1 cut(s) 119
BtsIMutI CAGTG 1 cut(s) 324
BveI ACCTGC 1 cut(s) 171
Cac8I GCNNGC 1 cut(s) 399
CseI GACGC 1 cut(s) 61
CviAII CATG 2 cut(s) 110, 398
CviJI RGCY 3 cut(s) 31, 124, 446
CviKI_1 RGCY 3 cut(s) 31, 124, 446
DpnI GATC 2 cut(s) 36, 339
DpnII GATC 2 cut(s) 34, 337
FaeI CATG 2 cut(s) 113, 401
FatI CATG 2 cut(s) 109, 397
FauNDI CATATG 1 cut(s) 389
FblI GTMKAC 1 cut(s) 118
HapII CCGG 2 cut(s) 219, 438
HgaI GACGC 1 cut(s) 61
Hin1II CATG 2 cut(s) 113, 401
HinfI GANTC 3 cut(s) 248, 290, 331
HpaII CCGG 2 cut(s) 219, 438
Hpy166II GTNNAC 2 cut(s) 18, 119
Hpy188I TCNGA 1 cut(s) 373
Hpy188III TCNNGA 5 cut(s) 85, 137, 252, 294, 335
Hpy8I GTNNAC 2 cut(s) 18, 119
HpyAV CCTTC 1 cut(s) 362
HpyCH4III ACNGT 1 cut(s) 328
HpyCH4V TGCA 4 cut(s) 25, 180, 401, 416
Hsp92II CATG 2 cut(s) 113, 401
Kzo9I GATC 2 cut(s) 34, 337
MaeIII GTNAC 1 cut(s) 320
MalI GATC 2 cut(s) 36, 339
MboI GATC 2 cut(s) 34, 337
MfeI CAATTG 2 cut(s) 203, 402
MluCI AATT 7 cut(s) 88, 132, 203, 225, 402, 408, 419
MnlI CCTC 2 cut(s) 92, 379
MseI TTAA 1 cut(s) 126
MslI CAYNNNNRTG 1 cut(s) 440
MspI CCGG 2 cut(s) 219, 438
MspR9I CCNGG 1 cut(s) 219
MunI CAATTG 2 cut(s) 203, 402
Mva1269I GAATGC 1 cut(s) 60
NciI CCSGG 1 cut(s) 219
NdeI CATATG 1 cut(s) 389
NdeII GATC 2 cut(s) 34, 337
NlaIII CATG 2 cut(s) 113, 401
NspI RCATGY 1 cut(s) 401
OliI CACNNNNGTG 1 cut(s) 440
PaeI GCATGC 1 cut(s) 401
PctI GAATGC 1 cut(s) 60
PfeI GAWTC 3 cut(s) 248, 290, 331
RseI CAYNNNNRTG 1 cut(s) 440
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 2 cut(s) 34, 337
ScrFI CCNGG 1 cut(s) 219
SetI ASST 3 cut(s) 84, 126, 185
SfcI CTRYAG 1 cut(s) 40
SmiMI CAYNNNNRTG 1 cut(s) 440
SphI GCATGC 1 cut(s) 401
Sse9I AATT 7 cut(s) 88, 132, 203, 225, 402, 408, 419
SsiI CCGC 1 cut(s) 364
StyD4I CCNGG 1 cut(s) 217
TaaI ACNGT 1 cut(s) 328
TaqI TCGA 2 cut(s) 102, 199
TasI AATT 7 cut(s) 88, 132, 203, 225, 402, 408, 419
TfiI GAWTC 3 cut(s) 248, 290, 331
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 1 cut(s) 331
TspGWI ACGGA 1 cut(s) 135
TspRI CASTG 1 cut(s) 331
XapI RAATTY 3 cut(s) 88, 132, 408
XceI RCATGY 1 cut(s) 401
XmiI GTMKAC 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.