Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0029445.1

Orthogroup ID

OG0020046

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 194

Gene Structure 194 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0029445.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 194 bp

gagtcgaaggtgtggtagaagaggttgaggtggagagagcagccgccaaagaagaagcgagactaggtcaagaagaagaagtcgaagtcaatgtggtagagacaggtggtgaggttgggggtggaggcattgtcggcgatggtggtggtggttatgagcagaatggcttgggatttaagaggcaaaatcaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

63

Amino Acids

6.5

Weight (kDa)

4.15

Isoelectric Point (pI)

42.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020046)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000035228
rosa_multiflora	Rmu_sc0002539.1_g000004 Rmu_sc0009526.1_g000011 Rmu_sc0010190.1_g000018 Rmu_sc0015096.1_g000001 Rmu_sc0029445.1_g000001
rosa_roxburghii	Rroxscaffold_1G00022010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	44
Alw26I	GTCTC	2 cut(s)	54, 94
ApeKI	GCWGC	1 cut(s)	40
AsuHPI	GGTGA	1 cut(s)	121
BbvI	GCAGC	1 cut(s)	52
BccI	CCATC	1 cut(s)	133
BcoDI	GTCTC	2 cut(s)	54, 94
BfaI	CTAG	1 cut(s)	64
BisI	GCNGC	2 cut(s)	41, 44
BlsI	GCNGC	2 cut(s)	42, 45
BsaXI	ACNNNNNCTCC	2 cut(s)	116, 146
BseXI	GCAGC	1 cut(s)	52
BsmAI	GTCTC	2 cut(s)	54, 94
BspACI	CCGC	1 cut(s)	44
Bst6I	CTCTTC	1 cut(s)	14
BstMAI	GTCTC	2 cut(s)	54, 94
BstMWI	GCNNNNNNNGC	1 cut(s)	134
BstV1I	GCAGC	1 cut(s)	52
BtgZI	GCGATG	1 cut(s)	152
CviJI	RGCY	2 cut(s)	43, 167
CviKI_1	RGCY	2 cut(s)	43, 167
Eam1104I	CTCTTC	1 cut(s)	14
EarI	CTCTTC	1 cut(s)	14
FaiI	YATR	1 cut(s)	155
Fnu4HI	GCNGC	2 cut(s)	41, 44
Fsp4HI	GCNGC	2 cut(s)	41, 44
FspBI	CTAG	1 cut(s)	64
GluI	GCNGC	2 cut(s)	41, 44
HinfI	GANTC	1 cut(s)	2
HphI	GGTGA	1 cut(s)	121
Hpy188III	TCNNGA	1 cut(s)	70
HpyF10VI	GCNNNNNNNGC	1 cut(s)	134
LpnPI	CCDG	1 cut(s)	89
Lsp1109I	GCAGC	1 cut(s)	52
MaeI	CTAG	1 cut(s)	64
MboII	GAAGA	4 cut(s)	31, 64, 85, 88
MlyI	GAGTC	1 cut(s)	11
MnlI	CCTC	5 cut(s)	15, 21, 105, 118, 173
MseI	TTAA	1 cut(s)	176
MwoI	GCNNNNNNNGC	1 cut(s)	134
PflFI	GACNNNGTC	1 cut(s)	65
PkrI	GCNGC	2 cut(s)	42, 45
PleI	GAGTC	1 cut(s)	10
PpsI	GAGTC	1 cut(s)	10
PsyI	GACNNNGTC	1 cut(s)	65
SaqAI	TTAA	1 cut(s)	176
SatI	GCNGC	2 cut(s)	41, 44
SchI	GAGTC	1 cut(s)	11
SetI	ASST	6 cut(s)	12, 26, 32, 69, 108, 116
SgeI	CNNG	5 cut(s)	71, 76, 82, 116, 180
SsiI	CCGC	1 cut(s)	44
SspMI	CTAG	1 cut(s)	64
TaqI	TCGA	2 cut(s)	5, 83
TauI	GCSGC	1 cut(s)	46
Tru1I	TTAA	1 cut(s)	176
Tru9I	TTAA	1 cut(s)	176
TseI	GCWGC	1 cut(s)	40
Tth111I	GACNNNGTC	1 cut(s)	65
XspI	CTAG	1 cut(s)	64

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.