Rmu_sc0039627.1_g000001
ERF Family

Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039627.1
Physical Location & Seq
Reverse (-)
435 .. 765
331 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039627.1_g000001.1.cds

Sequence Viewer

Length: 237 bp
atgtccaattttcttttcggttatcacataggggtgatgaatggtccgattgtttcgattgcccgagaactcggttttgaaggtaattcaattctcgaggggcttgtggtgagcatatttatagttggagcatttcttggaagcgtatgctgcggttcgattgtagataaacttggctgtaggaggacctttcagattgacaccattcctttgattcttggagcattgataaggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.33

Weight (kDa)

6.52

Isoelectric Point (pI)

17.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 153
AgsI TTSAA 2 cut(s) 80, 90
AjuI GAANNNNNNNTTGG 1 cut(s) 31
Ama87I CYCGRG 2 cut(s) 63, 95
ApeKI GCWGC 1 cut(s) 150
AspS9I GGNCC 2 cut(s) 44, 186
AsuHPI GGTGA 2 cut(s) 46, 121
AvaI CYCGRG 2 cut(s) 63, 95
AvaII GGWCC 2 cut(s) 44, 186
BbvI GCAGC 1 cut(s) 137
BfmI CTRYAG 1 cut(s) 178
BisI GCNGC 1 cut(s) 151
BlsI GCNGC 1 cut(s) 152
Bme18I GGWCC 2 cut(s) 44, 186
BmeT110I CYCGRG 2 cut(s) 63, 95
BmgT120I GGNCC 2 cut(s) 44, 186
BseXI GCAGC 1 cut(s) 137
BsiHKCI CYCGRG 2 cut(s) 63, 95
BsoBI CYCGRG 2 cut(s) 63, 95
BspACI CCGC 1 cut(s) 153
BstMWI GCNNNNNNNGC 1 cut(s) 150
BstSFI CTRYAG 1 cut(s) 178
BstV1I GCAGC 1 cut(s) 137
Cfr13I GGNCC 2 cut(s) 44, 186
CviJI RGCY 2 cut(s) 103, 177
CviKI_1 RGCY 2 cut(s) 103, 177
Eco47I GGWCC 2 cut(s) 44, 186
Eco88I CYCGRG 2 cut(s) 63, 95
EcoO109I RGGNCCY 1 cut(s) 186
FaiI YATR 4 cut(s) 29, 116, 122, 148
Fnu4HI GCNGC 1 cut(s) 151
Fsp4HI GCNGC 1 cut(s) 151
GluI GCNGC 1 cut(s) 151
HinfI GANTC 1 cut(s) 214
HphI GGTGA 2 cut(s) 46, 121
Hpy188I TCNGA 2 cut(s) 48, 195
Hpy188III TCNNGA 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 150
LmnI GCTCC 2 cut(s) 128, 221
Lsp1109I GCAGC 1 cut(s) 137
MluCI AATT 3 cut(s) 7, 85, 90
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 2 cut(s) 91, 177
MslI CAYNNNNRTG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 150
PaeR7I CTCGAG 1 cut(s) 95
PfeI GAWTC 1 cut(s) 214
PkrI GCNGC 1 cut(s) 152
PpuMI RGGWCCY 1 cut(s) 186
Psp5II RGGWCCY 1 cut(s) 186
PspPI GGNCC 2 cut(s) 44, 186
PspPPI RGGWCCY 1 cut(s) 186
RseI CAYNNNNRTG 1 cut(s) 32
SatI GCNGC 1 cut(s) 151
Sau96I GGNCC 2 cut(s) 44, 186
SetI ASST 3 cut(s) 85, 191, 236
SfcI CTRYAG 1 cut(s) 178
Sfr274I CTCGAG 1 cut(s) 95
SgeI CNNG 9 cut(s) 75, 77, 83, 107, 109, 116, 149, 185, 230
SinI GGWCC 2 cut(s) 44, 186
SlaI CTCGAG 1 cut(s) 95
SmiMI CAYNNNNRTG 1 cut(s) 32
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
Sse9I AATT 3 cut(s) 7, 85, 90
SsiI CCGC 1 cut(s) 153
TaqI TCGA 3 cut(s) 56, 96, 158
TasI AATT 3 cut(s) 7, 85, 90
TfiI GAWTC 1 cut(s) 214
TseI GCWGC 1 cut(s) 150
TspDTI ATGAA 1 cut(s) 53
VpaK11BI GGWCC 2 cut(s) 44, 186
XhoI CTCGAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.