Rmu_sc0040608.1_g000001

Aldo/keto reductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040608.1
Physical Location & Seq
Forward (+)
142 .. 1083
942 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040608.1_g000001.1.cds

Sequence Viewer

Length: 543 bp
atggggacatgggagacgatggaagagtgctacaggctgggattggccaagtctattggcgtcagcaacttcggtaccaaaaagctctctcaaatccttgacaacgggaccatccctccagcggtcaatcaggtggaaatgaacccgtcctggcagcaaggaaatctgcgagacttctgtaaagggaaaggaattcatgtgactgcatggtctcccttggggttttatggagctaccagctgggctccaaaaccctggatagactatgccatcattaaggacatcgctgctgcaaaggggaagagtgtagcacaggttatactgagatccatcatccaacaaggagaggtgagtgcaatttcgaggagtttcaacaaggagaggatgatggataatgctcaaatatttgattgggagctaagtgaggatgaaatgaacaagatcaaggaaattcctcagcgcaggttggctgtaggagacttcttcgtttccgaagaaggtcaatacaaatccctcgacgacctttgggatggcaacccctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

180

Amino Acids

20.23

Weight (kDa)

5.28

Isoelectric Point (pI)

35.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021078)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g17890
pyrus_communis pycom14g20320
rosa_chinensis RchiOBHm_Chr4g0445451
rosa_multiflora Rmu_sc0040608.1_g000001
rosa_rugosa Rorug04G0361400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 208
Acc36I ACCTGC 1 cut(s) 453
Acc65I GGTACC 1 cut(s) 74
AccB1I GGYRCC 1 cut(s) 74
AciI CCGC 1 cut(s) 122
AclWI GGATC 1 cut(s) 321
AcoI YGGCCR 1 cut(s) 45
AcsI RAATTY 2 cut(s) 192, 450
AcyI GRCGYC 1 cut(s) 60
AfaI GTAC 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 121
AgsI TTSAA 1 cut(s) 373
AjnI CCWGG 2 cut(s) 149, 254
AluBI AGCT 4 cut(s) 85, 233, 240, 418
AluI AGCT 4 cut(s) 85, 233, 240, 418
Alw26I GTCTC 4 cut(s) 8, 165, 216, 471
AlwI GGATC 1 cut(s) 321
AoxI GGCC 1 cut(s) 45
ApeKI GCWGC 3 cut(s) 154, 287, 290
ApoI RAATTY 2 cut(s) 192, 450
Asp718I GGTACC 1 cut(s) 74
AspLEI GCGC 1 cut(s) 462
AspS9I GGNCC 1 cut(s) 108
AsuHPI GGTGA 1 cut(s) 361
AvaII GGWCC 1 cut(s) 108
BaeI ACNNNNGTAYC 2 cut(s) 58, 91
BalI TGGCCA 1 cut(s) 47
BanI GGYRCC 1 cut(s) 74
BanII GRGCYC 1 cut(s) 247
BbvCI CCTCAGC 1 cut(s) 456
BbvI GCAGC 3 cut(s) 166, 274, 277
BccI CCATC 6 cut(s) 13, 119, 278, 338, 382, 524
BciT130I CCWGG 2 cut(s) 151, 256
BcoDI GTCTC 4 cut(s) 8, 165, 216, 471
BfmI CTRYAG 2 cut(s) 31, 471
BfuAI ACCTGC 1 cut(s) 453
BisI GCNGC 3 cut(s) 155, 288, 291
BlsI GCNGC 3 cut(s) 156, 289, 292
Bme1390I CCNGG 2 cut(s) 151, 256
Bme18I GGWCC 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 108
BmiI GGNNCC 3 cut(s) 76, 109, 246
BmrFI CCNGG 2 cut(s) 151, 256
BpmI CTGGAG 1 cut(s) 102
Bpu10I CCTNAGC 1 cut(s) 456
BsaHI GRCGYC 1 cut(s) 60
BsaI GGTCTC 1 cut(s) 216
BsaJI CCNNGG 2 cut(s) 216, 254
BsaXI ACNNNNNCTCC 2 cut(s) 100, 130
Bsc4I CCNNNNNNNGG 1 cut(s) 121
BseBI CCWGG 2 cut(s) 151, 256
BseDI CCNNGG 2 cut(s) 216, 254
BseGI GGATG 5 cut(s) 111, 333, 390, 433, 535
BseLI CCNNNNNNNGG 1 cut(s) 121
BseMII CTCAG 2 cut(s) 314, 470
BseRI GAGGAG 1 cut(s) 379
BseXI GCAGC 3 cut(s) 166, 274, 277
BseYI CCCAGC 2 cut(s) 37, 240
BshFI GGCC 1 cut(s) 47
BshNI GGYRCC 1 cut(s) 74
BslFI GGGAC 2 cut(s) 19, 121
BslI CCNNNNNNNGG 1 cut(s) 121
BsmAI GTCTC 4 cut(s) 8, 165, 216, 471
BsmBI CGTCTC 1 cut(s) 8
BsmFI GGGAC 2 cut(s) 19, 121
BsnI GGCC 1 cut(s) 47
Bso31I GGTCTC 1 cut(s) 216
Bsp1286I GDGCHC 1 cut(s) 247
Bsp143I GATC 2 cut(s) 326, 441
BspACI CCGC 1 cut(s) 122
BspANI GGCC 1 cut(s) 47
BspCNI CTCAG 2 cut(s) 315, 469
BspLI GGNNCC 3 cut(s) 76, 109, 246
BspMI ACCTGC 1 cut(s) 453
BspPI GGATC 1 cut(s) 321
BspT107I GGYRCC 1 cut(s) 74
BspTNI GGTCTC 1 cut(s) 216
BssECI CCNNGG 2 cut(s) 216, 254
BssMI GATC 2 cut(s) 326, 441
BssNI GRCGYC 1 cut(s) 60
BssT1I CCWWGG 1 cut(s) 216
Bst2UI CCWGG 2 cut(s) 151, 256
Bst6I CTCTTC 2 cut(s) 18, 296
BstACI GRCGYC 1 cut(s) 60
BstDEI CTNAG 3 cut(s) 323, 419, 456
BstF5I GGATG 5 cut(s) 111, 333, 390, 433, 535
BstHHI GCGC 1 cut(s) 462
BstKTI GATC 2 cut(s) 329, 444
BstMAI GTCTC 4 cut(s) 8, 165, 216, 471
BstMBI GATC 2 cut(s) 326, 441
BstNI CCWGG 2 cut(s) 151, 256
BstSCI CCNGG 2 cut(s) 149, 254
BstSFI CTRYAG 2 cut(s) 31, 471
BstV1I GCAGC 3 cut(s) 166, 274, 277
BstX2I RGATCY 1 cut(s) 326
BstXI CCANNNNNNTGG 1 cut(s) 255
BstYI RGATCY 1 cut(s) 326
BsuRI GGCC 1 cut(s) 47
BtgZI GCGATG 1 cut(s) 268
BtsCI GGATG 5 cut(s) 111, 333, 390, 433, 535
BveI ACCTGC 1 cut(s) 453
CfoI GCGC 1 cut(s) 462
Cfr13I GGNCC 1 cut(s) 108
CseI GACGC 1 cut(s) 49
Csp6I GTAC 1 cut(s) 75
CviAII CATG 3 cut(s) 9, 197, 207
CviJI RGCY 8 cut(s) 37, 47, 85, 233, 240, 245, 418, 470
CviKI_1 RGCY 8 cut(s) 37, 47, 85, 233, 240, 245, 418, 470
CviQI GTAC 1 cut(s) 75
DdeI CTNAG 3 cut(s) 323, 419, 456
DpnI GATC 2 cut(s) 328, 443
DpnII GATC 2 cut(s) 326, 441
DrdI GACNNNNNNGTC 1 cut(s) 208
DseDI GACNNNNNNGTC 1 cut(s) 208
EaeI YGGCCR 1 cut(s) 45
Eam1104I CTCTTC 2 cut(s) 18, 296
EarI CTCTTC 2 cut(s) 18, 296
Eco130I CCWWGG 1 cut(s) 216
Eco24I GRGCYC 1 cut(s) 247
Eco31I GGTCTC 1 cut(s) 216
Eco47I GGWCC 1 cut(s) 108
EcoRI GAATTC 1 cut(s) 192
EcoRII CCWGG 2 cut(s) 149, 254
EcoT14I CCWWGG 1 cut(s) 216
EcoT38I GRGCYC 1 cut(s) 247
ErhI CCWWGG 1 cut(s) 216
Esp3I CGTCTC 1 cut(s) 8
FaeI CATG 3 cut(s) 12, 200, 210
FaiI YATR 6 cut(s) 10, 198, 208, 228, 267, 320
FaqI GGGAC 2 cut(s) 19, 121
FatI CATG 3 cut(s) 8, 196, 206
Fnu4HI GCNGC 3 cut(s) 155, 288, 291
FokI GGATG 4 cut(s) 98, 320, 397, 440
FriOI GRGCYC 1 cut(s) 247
Fsp4HI GCNGC 3 cut(s) 155, 288, 291
GlaI GCGC 1 cut(s) 461
GluI GCNGC 3 cut(s) 155, 288, 291
GsaI CCCAGC 2 cut(s) 41, 244
GsuI CTGGAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 47
HgaI GACGC 1 cut(s) 49
HhaI GCGC 1 cut(s) 462
Hin1I GRCGYC 1 cut(s) 60
Hin1II CATG 3 cut(s) 12, 200, 210
Hin6I GCGC 1 cut(s) 460
HinP1I GCGC 1 cut(s) 460
HphI GGTGA 1 cut(s) 361
Hpy188I TCNGA 1 cut(s) 493
Hpy99I CGWCG 1 cut(s) 521
HpyAV CCTTC 1 cut(s) 491
HpyCH4V TGCA 3 cut(s) 206, 293, 356
HpyF3I CTNAG 3 cut(s) 323, 419, 456
Hsp92I GRCGYC 1 cut(s) 60
Hsp92II CATG 3 cut(s) 12, 200, 210
HspAI GCGC 1 cut(s) 460
KpnI GGTACC 1 cut(s) 78
Kzo9I GATC 2 cut(s) 326, 441
LmnI GCTCC 3 cut(s) 230, 250, 415
Lsp1109I GCAGC 3 cut(s) 166, 274, 277
MaeIII GTNAC 1 cut(s) 199
MalI GATC 2 cut(s) 328, 443
MboI GATC 2 cut(s) 326, 441
MboII GAAGA 4 cut(s) 35, 313, 475, 506
MflI RGATCY 1 cut(s) 326
MhlI GDGCHC 1 cut(s) 247
MlsI TGGCCA 1 cut(s) 47
MluCI AATT 3 cut(s) 192, 357, 450
MluNI TGGCCA 1 cut(s) 47
MmeI TCCRAC 1 cut(s) 361
MnlI CCTC 7 cut(s) 126, 340, 357, 375, 418, 465, 524
Mox20I TGGCCA 1 cut(s) 47
MscI TGGCCA 1 cut(s) 47
MseI TTAA 1 cut(s) 276
Msp20I TGGCCA 1 cut(s) 47
MspA1I CMGCKG 2 cut(s) 122, 240
MspR9I CCNGG 2 cut(s) 151, 256
MvaI CCWGG 2 cut(s) 151, 256
NdeII GATC 2 cut(s) 326, 441
NlaIII CATG 3 cut(s) 12, 200, 210
NlaIV GGNNCC 3 cut(s) 76, 109, 246
NmuCI GTSAC 1 cut(s) 199
PkrI GCNGC 3 cut(s) 156, 289, 292
Psp6I CCWGG 2 cut(s) 149, 254
PspFI CCCAGC 2 cut(s) 37, 240
PspGI CCWGG 2 cut(s) 149, 254
PspN4I GGNNCC 3 cut(s) 76, 109, 246
PspPI GGNCC 1 cut(s) 108
PsuI RGATCY 1 cut(s) 326
PvuII CAGCTG 1 cut(s) 240
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
SaqAI TTAA 1 cut(s) 276
SatI GCNGC 3 cut(s) 155, 288, 291
Sau3AI GATC 2 cut(s) 326, 441
Sau96I GGNCC 1 cut(s) 108
ScrFI CCNGG 2 cut(s) 151, 256
SduI GDGCHC 1 cut(s) 247
SfcI CTRYAG 2 cut(s) 31, 471
SinI GGWCC 1 cut(s) 108
Sse9I AATT 3 cut(s) 192, 357, 450
SsiI CCGC 1 cut(s) 122
SspI AATATT 1 cut(s) 405
StyD4I CCNGG 2 cut(s) 149, 254
StyI CCWWGG 1 cut(s) 216
TaqI TCGA 2 cut(s) 362, 516
TasI AATT 3 cut(s) 192, 357, 450
Tru1I TTAA 1 cut(s) 276
Tru9I TTAA 1 cut(s) 276
TseFI GTSAC 1 cut(s) 199
TseI GCWGC 3 cut(s) 154, 287, 290
Tsp45I GTSAC 1 cut(s) 199
TspDTI ATGAA 4 cut(s) 155, 185, 444, 449
VpaK11BI GGWCC 1 cut(s) 108
XapI RAATTY 2 cut(s) 192, 450
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.