Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000138.1

Orthogroup ID

OG0002835

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1688

Gene Structure 1688 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1098 bp

gcattggaacgtggaattccagcagtccttggcattatttccactcagaggcttccttttccctcaaagtcatttgatatggctcactgttctagatgccttatcccatggacagaattcggtggaatttacctgctagaagttcatcgcatacttcgtcctggaggtttctgggtcctctctggtccacctgtcaactatgaaaaccgctggcgtggatggaacacaactatagaagaccagaaatcagattacgagaagttgcaagatctgctaacttcattgtgcttcaaattgtacaacaaaaaggatgacattgctgtttggcagaagttgtcggacaatagttgctatgataagctctctgaaccagatacctatcctgcaaagtgtgatgatagtcttgaaccagattcagcatggtacactccattgcgctcttgtgtagtcgttccaaacccaaagcacaagaggtcatctttggacaccatccctaaatggccagagcggttgcatgttgcaccagaacgtatttctgatgttcatggtgggagtgctagtgctctgaagcatgatgatggcaagtggaagatacgattgcagcactacaagaagttgctcccagcagttggaacagataagatcagaaatgttatggacatgaataccgtgtatggagggcttgcagcagcctcaattgatgatcccttgtgggtcatgaatgtggtttcttcctacgctgcaaatacactgcctgtggtctatgatcggggccttattggaacataccatgactggtgcgaagctttctctacatatccccgaacttatgatcttctacatcttgatggcctatttactgcagaaagccacagatgcgaaatgaaatacgtgctcctagagatggaccgcatcctacgccccaatggctatgcaataattcgggaatccagctactttgtggatgctgtcgcaactattgccaaagggatgagatggggatgtcgcaaagaagataccgagtatagtgttgagaaggagaaaatattgatctgccagaaaaagctctggtattcatctaaccagaattctagatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0008150 GO:0008152 GO:0008168 GO:0008757 GO:0012505 GO:0016740 GO:0016741 GO:0031410 GO:0031982 GO:0031984 GO:0032259 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0097708 GO:0098791

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Methyltransf_29

Protein Analysis

365

Amino Acids

41.87

Weight (kDa)

7.68

Isoelectric Point (pI)

41.22

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Methyltransf_29	PF03141	1 - 354	2.2e-139	Putative S-adenosyl-L-methionine-dependent methyltransferase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002835)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G31850 AT1G31850 AT1G31850 AT1G31850 AT4G19120 AT4G19120 AT4G19120
fragaria_vesca	FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930 FvH4_5g23930
malus_domestica	MD00G1001500.v1.1 MD06G1015000.v1.1
prunus_persica	Prupe.5G021100_v2.0.a1 Prupe.5G021100_v2.0.a1
pyrus_communis	pycom06g01220 pycom16g25450
rosa_chinensis	RchiOBHm_Chr7g0213351
rosa_laevigata	RLG00000002812
rosa_multiflora	Rmu_ssc0000138.1_g000001
rosa_roxburghii	Rroxscaffold_3G00246060
rosa_rugosa	Rorug07G0141400 Rorug07G0141500
rosa_samantha	Rh7AG273200 Rh7BG268600 Rh7CG292400 Rh7DG280800
rosa_wichuraiana	Rw7G023700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	141
AccB7I	CCANNNNNTGG	1 cut(s)	629
AccBSI	CCGCTC	1 cut(s)	508
AciI	CCGC	3 cut(s)	208, 508, 910
AclWI	GGATC	1 cut(s)	698
AcoI	YGGCCR	1 cut(s)	500
AcsI	RAATTY	4 cut(s)	15, 116, 126, 1087
AcuI	CTGAAG	1 cut(s)	587
AfaI	GTAC	2 cut(s)	299, 425
AfiI	CCNNNNNNNGG	3 cut(s)	48, 629, 904
AgsI	TTSAA	2 cut(s)	292, 407
AjnI	CCWGG	1 cut(s)	160
AluBI	AGCT	4 cut(s)	361, 806, 954, 1066
AluI	AGCT	4 cut(s)	361, 806, 954, 1066
Alw21I	GWGCWC	2 cut(s)	565, 897
AlwI	GGATC	1 cut(s)	698
AoxI	GGCC	3 cut(s)	500, 772, 850
ApeKI	GCWGC	4 cut(s)	601, 686, 689, 740
ApoI	RAATTY	4 cut(s)	15, 116, 126, 1087
AspLEI	GCGC	1 cut(s)	438
AspS9I	GGNCC	4 cut(s)	175, 185, 772, 907
AvaII	GGWCC	3 cut(s)	175, 185, 907
BalI	TGGCCA	1 cut(s)	502
BbsI	GAAGAC	1 cut(s)	243
Bbv12I	GWGCWC	2 cut(s)	565, 897
BbvI	GCAGC	4 cut(s)	613, 698, 701, 727
BccI	CCATC	6 cut(s)	213, 497, 572, 842, 898, 990
BciT130I	CCWGG	1 cut(s)	162
BfaI	CTAG	5 cut(s)	93, 137, 558, 899, 1092
BfmI	CTRYAG	2 cut(s)	231, 861
BfuAI	ACCTGC	1 cut(s)	141
BglI	GCCNNNNNGGC	1 cut(s)	927
BglII	AGATCT	1 cut(s)	268
BisI	GCNGC	4 cut(s)	602, 687, 690, 741
BlsI	GCNGC	4 cut(s)	603, 688, 691, 742
Bme1390I	CCNGG	1 cut(s)	162
Bme18I	GGWCC	3 cut(s)	175, 185, 907
BmgT120I	GGNCC	4 cut(s)	175, 185, 772, 907
BmiI	GGNNCC	2 cut(s)	176, 773
BmrFI	CCNGG	1 cut(s)	162
BmsI	GCATC	4 cut(s)	86, 866, 921, 955
BpiI	GAAGAC	1 cut(s)	243
BpmI	CTGGAG	1 cut(s)	183
BsaAI	YACGTR	1 cut(s)	892
BsaBI	GATNNNNATC	1 cut(s)	378
BsaJI	CCNNGG	2 cut(s)	28, 107
BsaXI	ACNNNNNCTCC	2 cut(s)	544, 574
Bsc4I	CCNNNNNNNGG	3 cut(s)	48, 629, 904
Bse1I	ACTGG	1 cut(s)	800
Bse3DI	GCAATG	2 cut(s)	315, 431
Bse8I	GATNNNNATC	1 cut(s)	378
BseBI	CCWGG	1 cut(s)	162
BseDI	CCNNGG	2 cut(s)	28, 107
BseGI	GGATG	7 cut(s)	224, 316, 489, 912, 970, 996, 1007
BseJI	GATNNNNATC	1 cut(s)	378
BseLI	CCNNNNNNNGG	3 cut(s)	48, 629, 904
BseMI	GCAATG	2 cut(s)	315, 431
BseMII	CTCAG	1 cut(s)	59
BseNI	ACTGG	1 cut(s)	800
BseXI	GCAGC	4 cut(s)	613, 698, 701, 727
BseYI	CCCAGC	1 cut(s)	622
BshFI	GGCC	3 cut(s)	502, 774, 852
BsiHKAI	GWGCWC	2 cut(s)	565, 897
BslI	CCNNNNNNNGG	3 cut(s)	48, 629, 904
BsnI	GGCC	3 cut(s)	502, 774, 852
Bsp1286I	GDGCHC	2 cut(s)	565, 897
Bsp1407I	TGTACA	1 cut(s)	297
Bsp143I	GATC	6 cut(s)	268, 642, 703, 766, 832, 1050
Bsp19I	CCATGG	1 cut(s)	107
BspACI	CCGC	3 cut(s)	208, 508, 910
BspANI	GGCC	3 cut(s)	502, 774, 852
BspCNI	CTCAG	1 cut(s)	58
BspHI	TCATGA	1 cut(s)	717
BspLI	GGNNCC	2 cut(s)	176, 773
BspMAI	CTGCAG	1 cut(s)	865
BspMI	ACCTGC	1 cut(s)	141
BspPI	GGATC	1 cut(s)	698
BsrBI	CCGCTC	1 cut(s)	508
BsrDI	GCAATG	2 cut(s)	315, 431
BsrGI	TGTACA	1 cut(s)	297
BsrI	ACTGG	1 cut(s)	800
BssECI	CCNNGG	2 cut(s)	28, 107
BssMI	GATC	6 cut(s)	268, 642, 703, 766, 832, 1050
BssT1I	CCWWGG	2 cut(s)	28, 107
Bst2UI	CCWGG	1 cut(s)	162
Bst4CI	ACNGT	2 cut(s)	89, 670
BstAPI	GCANNNNNTGC	2 cut(s)	271, 980
BstAUI	TGTACA	1 cut(s)	297
BstBAI	YACGTR	1 cut(s)	892
BstC8I	GCNNGC	2 cut(s)	212, 684
BstDEI	CTNAG	1 cut(s)	45
BstDSI	CCRYGG	1 cut(s)	107
BstF5I	GGATG	7 cut(s)	224, 316, 489, 912, 970, 996, 1007
BstHHI	GCGC	1 cut(s)	438
BstKTI	GATC	6 cut(s)	271, 645, 706, 769, 835, 1053
BstMBI	GATC	6 cut(s)	268, 642, 703, 766, 832, 1050
BstMWI	GCNNNNNNNGC	5 cut(s)	271, 876, 918, 927, 980
BstNI	CCWGG	1 cut(s)	162
BstNSI	RCATGY	1 cut(s)	518
BstSCI	CCNGG	1 cut(s)	160
BstSFI	CTRYAG	2 cut(s)	231, 861
BstV1I	GCAGC	4 cut(s)	613, 698, 701, 727
BstV2I	GAAGAC	1 cut(s)	243
BstX2I	RGATCY	1 cut(s)	268
BstYI	RGATCY	1 cut(s)	268
BsuRI	GGCC	3 cut(s)	502, 774, 852
BtgI	CCRYGG	1 cut(s)	107
BtgZI	GCGATG	1 cut(s)	131
BtsCI	GGATG	7 cut(s)	224, 316, 489, 912, 970, 996, 1007
BtsI	GCAGTG	1 cut(s)	749
BtsIMutI	CAGTG	2 cut(s)	85, 749
BveI	ACCTGC	1 cut(s)	141
Cac8I	GCNNGC	2 cut(s)	212, 684
CciI	TCATGA	1 cut(s)	717
CfoI	GCGC	1 cut(s)	438
Cfr13I	GGNCC	4 cut(s)	175, 185, 772, 907
Csp6I	GTAC	2 cut(s)	298, 424
CviAII	CATG	8 cut(s)	108, 420, 515, 545, 572, 661, 718, 791
CviQI	GTAC	2 cut(s)	298, 424
DdeI	CTNAG	1 cut(s)	45
DpnI	GATC	6 cut(s)	270, 644, 705, 768, 834, 1052
DpnII	GATC	6 cut(s)	268, 642, 703, 766, 832, 1050
EaeI	YGGCCR	1 cut(s)	500
Eco130I	CCWWGG	2 cut(s)	28, 107
Eco47I	GGWCC	3 cut(s)	175, 185, 907
Eco57I	CTGAAG	1 cut(s)	587
EcoO109I	RGGNCCY	2 cut(s)	175, 772
EcoRI	GAATTC	3 cut(s)	15, 116, 1087
EcoRII	CCWGG	1 cut(s)	160
EcoT14I	CCWWGG	2 cut(s)	28, 107
ErhI	CCWWGG	2 cut(s)	28, 107
FaeI	CATG	8 cut(s)	111, 423, 518, 548, 575, 664, 721, 794
FatI	CATG	8 cut(s)	107, 419, 514, 544, 571, 660, 717, 790
Fnu4HI	GCNGC	4 cut(s)	602, 687, 690, 741
FokI	GGATG	7 cut(s)	231, 323, 476, 899, 977, 1003, 1014
Fsp4HI	GCNGC	4 cut(s)	602, 687, 690, 741
FspBI	CTAG	5 cut(s)	93, 137, 558, 899, 1092
GlaI	GCGC	1 cut(s)	437
GluI	GCNGC	4 cut(s)	602, 687, 690, 741
GsaI	CCCAGC	1 cut(s)	626
GsuI	CTGGAG	1 cut(s)	183
HaeIII	GGCC	3 cut(s)	502, 774, 852
HhaI	GCGC	1 cut(s)	438
Hin1II	CATG	8 cut(s)	111, 423, 518, 548, 575, 664, 721, 794
Hin6I	GCGC	1 cut(s)	436
HinP1I	GCGC	1 cut(s)	436
HincII	GTYRAC	1 cut(s)	196
HindII	GTYRAC	1 cut(s)	196
HindIII	AAGCTT	1 cut(s)	804
HinfI	GANTC	2 cut(s)	413, 947
Hpy166II	GTNNAC	3 cut(s)	188, 196, 426
Hpy188I	TCNGA	7 cut(s)	48, 250, 340, 367, 538, 567, 647
Hpy188III	TCNNGA	6 cut(s)	93, 404, 718, 845, 944, 1092
Hpy8I	GTNNAC	3 cut(s)	188, 196, 426
HpyAV	CCTTC	1 cut(s)	1030
HpyCH4III	ACNGT	2 cut(s)	89, 670
HpyCH4IV	ACGT	3 cut(s)	10, 529, 891
HpyCH4V	TGCA	9 cut(s)	265, 386, 514, 521, 601, 686, 743, 863, 935
HpyF10VI	GCNNNNNNNGC	5 cut(s)	271, 876, 918, 927, 980
HpyF3I	CTNAG	1 cut(s)	45
HpySE526I	ACGT	3 cut(s)	10, 529, 891
Hsp92II	CATG	8 cut(s)	111, 423, 518, 548, 575, 664, 721, 794
HspAI	GCGC	1 cut(s)	436
Kzo9I	GATC	6 cut(s)	268, 642, 703, 766, 832, 1050
LmnI	GCTCC	2 cut(s)	624, 900
Lsp1109I	GCAGC	4 cut(s)	613, 698, 701, 727
LweI	GCATC	4 cut(s)	86, 866, 921, 955
MaeI	CTAG	5 cut(s)	93, 137, 558, 899, 1092
MaeII	ACGT	3 cut(s)	10, 529, 891
MalI	GATC	6 cut(s)	270, 644, 705, 768, 834, 1052
MbiI	CCGCTC	1 cut(s)	508
MboI	GATC	6 cut(s)	268, 642, 703, 766, 832, 1050
MboII	GAAGA	5 cut(s)	248, 601, 723, 827, 1025
MfeI	CAATTG	1 cut(s)	696
MflI	RGATCY	1 cut(s)	268
MhlI	GDGCHC	2 cut(s)	565, 897
MlsI	TGGCCA	1 cut(s)	502
MluCI	AATT	7 cut(s)	15, 116, 126, 293, 696, 939, 1087
MluNI	TGGCCA	1 cut(s)	502
MmeI	TCCRAC	2 cut(s)	318, 610
MnlI	CCTC	7 cut(s)	42, 73, 158, 188, 465, 671, 703
Mox20I	TGGCCA	1 cut(s)	502
MscI	TGGCCA	1 cut(s)	502
MslI	CAYNNNNRTG	3 cut(s)	576, 722, 846
Msp20I	TGGCCA	1 cut(s)	502
MspA1I	CMGCKG	1 cut(s)	210
MspR9I	CCNGG	1 cut(s)	162
MunI	CAATTG	1 cut(s)	696
MvaI	CCWGG	1 cut(s)	162
MwoI	GCNNNNNNNGC	5 cut(s)	271, 876, 918, 927, 980
NcoI	CCATGG	1 cut(s)	107
NdeII	GATC	6 cut(s)	268, 642, 703, 766, 832, 1050
NlaIII	CATG	8 cut(s)	111, 423, 518, 548, 575, 664, 721, 794
NlaIV	GGNNCC	2 cut(s)	176, 773
NspI	RCATGY	1 cut(s)	518
PagI	TCATGA	1 cut(s)	717
PcsI	WCGNNNNNNNCGW	1 cut(s)	154
PfeI	GAWTC	2 cut(s)	413, 947
PflMI	CCANNNNNTGG	1 cut(s)	629
PfoI	TCCNGGA	1 cut(s)	160
PkrI	GCNGC	4 cut(s)	603, 688, 691, 742
Ppu21I	YACGTR	1 cut(s)	892
PpuMI	RGGWCCY	1 cut(s)	175
Psp5II	RGGWCCY	1 cut(s)	175
Psp6I	CCWGG	1 cut(s)	160
PspFI	CCCAGC	1 cut(s)	622
PspGI	CCWGG	1 cut(s)	160
PspN4I	GGNNCC	2 cut(s)	176, 773
PspPI	GGNCC	4 cut(s)	175, 185, 772, 907
PspPPI	RGGWCCY	1 cut(s)	175
PstI	CTGCAG	1 cut(s)	865
PsuI	RGATCY	1 cut(s)	268
RsaI	GTAC	2 cut(s)	299, 425
RsaNI	GTAC	2 cut(s)	298, 424
RseI	CAYNNNNRTG	3 cut(s)	576, 722, 846
SatI	GCNGC	4 cut(s)	602, 687, 690, 741
Sau3AI	GATC	6 cut(s)	268, 642, 703, 766, 832, 1050
Sau96I	GGNCC	4 cut(s)	175, 185, 772, 907
ScrFI	CCNGG	1 cut(s)	162
SduI	GDGCHC	2 cut(s)	565, 897
SfaNI	GCATC	4 cut(s)	86, 866, 921, 955
SfcI	CTRYAG	2 cut(s)	231, 861
SinI	GGWCC	3 cut(s)	175, 185, 907
SmiMI	CAYNNNNRTG	3 cut(s)	576, 722, 846
Sse9I	AATT	7 cut(s)	15, 116, 126, 293, 696, 939, 1087
SsiI	CCGC	3 cut(s)	208, 508, 910
SspI	AATATT	1 cut(s)	1047
SspMI	CTAG	5 cut(s)	93, 137, 558, 899, 1092
StyD4I	CCNGG	1 cut(s)	160
StyI	CCWWGG	2 cut(s)	28, 107
TaaI	ACNGT	2 cut(s)	89, 670
TaiI	ACGT	3 cut(s)	13, 532, 894
TasI	AATT	7 cut(s)	15, 116, 126, 293, 696, 939, 1087
TatI	WGTACW	1 cut(s)	297
TfiI	GAWTC	2 cut(s)	413, 947
TscAI	CASTG	2 cut(s)	92, 756
TseI	GCWGC	4 cut(s)	601, 686, 689, 740
TspDTI	ATGAA	8 cut(s)	134, 216, 270, 533, 677, 734, 899, 1065
TspRI	CASTG	2 cut(s)	92, 756
Van91I	CCANNNNNTGG	1 cut(s)	629
VpaK11BI	GGWCC	3 cut(s)	175, 185, 907
XapI	RAATTY	4 cut(s)	15, 116, 126, 1087
XbaI	TCTAGA	2 cut(s)	92, 1091
XceI	RCATGY	1 cut(s)	518
XcmI	CCANNNNNNNNNTGG	2 cut(s)	417, 958
XspI	CTAG	5 cut(s)	93, 137, 558, 899, 1092

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.