Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000160.1

Orthogroup ID

OG0021617

Physical Location & Seq

Genomic Coordinates Reverse (-)

42442 .. 43457

Gene Structure 1016 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000160.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 504 bp

atgattccggtcacccgtcgcatgattccggtcatcgacagccagaatccgaaagacttggaatttgtcgatgctataatcaaggtaaagaatcgagaccctatcttgaaaaacaaagaggtcgagttatttaaatctgatgaaactgaggttgaagatgctggtaatgaaactgaagatactagtctagtgaaagaggaggataacaaaactaagaagaagaagaagaagaaggtctacttgaaggatgacacggtccgattgcagaaacaccgccggaagtttagaaacttcgggcctctgattctctctacagccaattcatgtacgattcgaggaagaaaagcggaggcggaagaaaagcggatcgagattttccgggaactggttgagagagagagagagaggcgtttcggggaaggaatgccgaaaaattcaccggcgagatcccggcgactcaactccaagtccagccacgactcctactttcttatctgcaagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kri1 Kri1_C

Protein Analysis

167

Amino Acids

19.65

Weight (kDa)

9.69

Isoelectric Point (pI)

57.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021617)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0004288.1_g000009 Rmu_sc0006406.1_g000009 Rmu_ssc0000160.1_g000007
rosa_roxburghii	Rroxscaffold_4G00290580
rosa_samantha	Rh1CG312300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	237
AciI	CCGC	4 cut(s)	274, 347, 353, 364
AclWI	GGATC	2 cut(s)	374, 441
AcsI	RAATTY	2 cut(s)	62, 433
AcuI	CTGAAG	1 cut(s)	195
AfaI	GTAC	1 cut(s)	328
AfiI	CCNNNNNNNGG	1 cut(s)	385
AgsI	TTSAA	3 cut(s)	109, 155, 244
AhlI	ACTAGT	1 cut(s)	182
Alw26I	GTCTC	1 cut(s)	90
AlwI	GGATC	2 cut(s)	374, 441
AoxI	GGCC	1 cut(s)	296
ApoI	RAATTY	2 cut(s)	62, 433
ArsI	GACNNNNNNTTYG	2 cut(s)	47, 79
AspS9I	GGNCC	2 cut(s)	256, 296
AsuC2I	CCSGG	2 cut(s)	380, 451
AsuHPI	GGTGA	2 cut(s)	4, 429
AvaII	GGWCC	1 cut(s)	256
BarI	GAAGNNNNNNTAC	2 cut(s)	221, 253
BcnI	CCSGG	2 cut(s)	380, 451
BcoDI	GTCTC	1 cut(s)	90
BcuI	ACTAGT	1 cut(s)	182
BfaI	CTAG	2 cut(s)	183, 188
BfmI	CTRYAG	1 cut(s)	312
Bme1390I	CCNGG	2 cut(s)	380, 451
Bme18I	GGWCC	1 cut(s)	256
BmgT120I	GGNCC	2 cut(s)	256, 296
BmrFI	CCNGG	2 cut(s)	380, 451
BmsI	GCATC	2 cut(s)	61, 148
BpuMI	CCSGG	2 cut(s)	380, 451
BsaI	GGTCTC	1 cut(s)	90
BsaWI	WCCGGW	2 cut(s)	7, 28
Bsc4I	CCNNNNNNNGG	1 cut(s)	385
Bse118I	RCCGGY	1 cut(s)	439
Bse1I	ACTGG	1 cut(s)	390
BseGI	GGATG	1 cut(s)	253
BseLI	CCNNNNNNNGG	1 cut(s)	385
BseMII	CTCAG	1 cut(s)	138
BseNI	ACTGG	1 cut(s)	390
BseRI	GAGGAG	1 cut(s)	212
BshFI	GGCC	1 cut(s)	298
BsiSI	CCGG	6 cut(s)	8, 29, 277, 379, 440, 451
BslI	CCNNNNNNNGG	1 cut(s)	385
BsmAI	GTCTC	1 cut(s)	90
BsmI	GAATGC	1 cut(s)	429
BsnI	GGCC	1 cut(s)	298
Bso31I	GGTCTC	1 cut(s)	90
Bsp143I	GATC	2 cut(s)	366, 446
BspACI	CCGC	4 cut(s)	274, 347, 353, 364
BspANI	GGCC	1 cut(s)	298
BspCNI	CTCAG	1 cut(s)	139
BspPI	GGATC	2 cut(s)	374, 441
BspTNI	GGTCTC	1 cut(s)	90
BsrFI	RCCGGY	1 cut(s)	439
BsrI	ACTGG	1 cut(s)	390
BssAI	RCCGGY	1 cut(s)	439
BssMI	GATC	2 cut(s)	366, 446
Bst4CI	ACNGT	1 cut(s)	256
BstDEI	CTNAG	2 cut(s)	147, 213
BstEII	GGTNACC	1 cut(s)	10
BstF5I	GGATG	1 cut(s)	253
BstKTI	GATC	2 cut(s)	369, 449
BstMAI	GTCTC	1 cut(s)	90
BstMBI	GATC	2 cut(s)	366, 446
BstPI	GGTNACC	1 cut(s)	10
BstSCI	CCNGG	2 cut(s)	378, 449
BstSFI	CTRYAG	1 cut(s)	312
BstX2I	RGATCY	1 cut(s)	446
BstYI	RGATCY	1 cut(s)	446
BsuRI	GGCC	1 cut(s)	298
BtsCI	GGATG	1 cut(s)	253
Cfr10I	RCCGGY	1 cut(s)	439
Cfr13I	GGNCC	2 cut(s)	256, 296
CpoI	CGGWCCG	1 cut(s)	256
Csp6I	GTAC	1 cut(s)	327
CspI	CGGWCCG	1 cut(s)	256
CviAII	CATG	2 cut(s)	22, 324
CviJI	RGCY	4 cut(s)	42, 298, 317, 474
CviKI_1	RGCY	4 cut(s)	42, 298, 317, 474
CviQI	GTAC	1 cut(s)	327
DdeI	CTNAG	2 cut(s)	147, 213
DpnI	GATC	2 cut(s)	368, 448
DpnII	GATC	2 cut(s)	366, 446
DraI	TTTAAA	1 cut(s)	133
EciI	GGCGGA	1 cut(s)	368
Eco31I	GGTCTC	1 cut(s)	90
Eco47I	GGWCC	1 cut(s)	256
Eco57I	CTGAAG	1 cut(s)	195
Eco91I	GGTNACC	1 cut(s)	10
EcoO65I	GGTNACC	1 cut(s)	10
FaeI	CATG	2 cut(s)	25, 327
FaiI	YATR	3 cut(s)	23, 77, 325
FalI	AAGNNNNNCTT	2 cut(s)	224, 256
FatI	CATG	2 cut(s)	21, 323
FblI	GTMKAC	1 cut(s)	237
FokI	GGATG	1 cut(s)	260
FspBI	CTAG	2 cut(s)	183, 188
HaeIII	GGCC	1 cut(s)	298
HapII	CCGG	6 cut(s)	8, 29, 277, 379, 440, 451
Hin1II	CATG	2 cut(s)	25, 327
HinfI	GANTC	8 cut(s)	4, 25, 46, 91, 304, 331, 456, 479
HpaII	CCGG	6 cut(s)	8, 29, 277, 379, 440, 451
HphI	GGTGA	2 cut(s)	4, 429
Hpy166II	GTNNAC	1 cut(s)	238
Hpy188I	TCNGA	4 cut(s)	51, 139, 260, 303
Hpy188III	TCNNGA	3 cut(s)	95, 106, 370
Hpy8I	GTNNAC	1 cut(s)	238
Hpy99I	CGWCG	1 cut(s)	21
HpyAV	CCTTC	3 cut(s)	226, 238, 413
HpyCH4III	ACNGT	1 cut(s)	256
HpyCH4V	TGCA	2 cut(s)	265, 498
HpyF3I	CTNAG	2 cut(s)	147, 213
Hsp92II	CATG	2 cut(s)	25, 327
Kzo9I	GATC	2 cut(s)	366, 446
LweI	GCATC	2 cut(s)	61, 148
MaeI	CTAG	2 cut(s)	183, 188
MaeIII	GTNAC	1 cut(s)	10
MalI	GATC	2 cut(s)	368, 448
MboI	GATC	2 cut(s)	366, 446
MboII	GAAGA	9 cut(s)	167, 188, 229, 232, 235, 238, 241, 351, 368
MflI	RGATCY	1 cut(s)	446
MluCI	AATT	3 cut(s)	62, 319, 433
MlyI	GAGTC	2 cut(s)	450, 473
MnlI	CCTC	8 cut(s)	112, 142, 190, 193, 309, 329, 343, 399
MseI	TTAA	1 cut(s)	132
MspI	CCGG	6 cut(s)	8, 29, 277, 379, 440, 451
MspR9I	CCNGG	2 cut(s)	380, 451
Mva1269I	GAATGC	1 cut(s)	429
NciI	CCSGG	2 cut(s)	380, 451
NdeII	GATC	2 cut(s)	366, 446
NlaIII	CATG	2 cut(s)	25, 327
NmuCI	GTSAC	1 cut(s)	10
PctI	GAATGC	1 cut(s)	429
PfeI	GAWTC	6 cut(s)	4, 25, 46, 91, 304, 331
PflFI	GACNNNGTC	1 cut(s)	254
PfoI	TCCNGGA	1 cut(s)	378
PleI	GAGTC	2 cut(s)	450, 473
PpsI	GAGTC	2 cut(s)	450, 473
PspEI	GGTNACC	1 cut(s)	10
PspPI	GGNCC	2 cut(s)	256, 296
PsuI	RGATCY	1 cut(s)	446
PsyI	GACNNNGTC	1 cut(s)	254
RsaI	GTAC	1 cut(s)	328
RsaNI	GTAC	1 cut(s)	327
Rsr2I	CGGWCCG	1 cut(s)	256
RsrII	CGGWCCG	1 cut(s)	256
SaqAI	TTAA	1 cut(s)	132
Sau3AI	GATC	2 cut(s)	366, 446
Sau96I	GGNCC	2 cut(s)	256, 296
SchI	GAGTC	2 cut(s)	450, 473
ScrFI	CCNGG	2 cut(s)	380, 451
SetI	ASST	4 cut(s)	87, 123, 153, 237
SfaNI	GCATC	2 cut(s)	61, 148
SfcI	CTRYAG	1 cut(s)	312
SgrAI	CRCCGGYG	1 cut(s)	439
SinI	GGWCC	1 cut(s)	256
SmiI	ATTTAAAT	1 cut(s)	133
SpeI	ACTAGT	1 cut(s)	182
Sse9I	AATT	3 cut(s)	62, 319, 433
SsiI	CCGC	4 cut(s)	274, 347, 353, 364
SspMI	CTAG	2 cut(s)	183, 188
StyD4I	CCNGG	2 cut(s)	378, 449
SwaI	ATTTAAAT	1 cut(s)	133
TaaI	ACNGT	1 cut(s)	256
TaqI	TCGA	6 cut(s)	36, 69, 94, 123, 334, 369
TasI	AATT	3 cut(s)	62, 319, 433
TfiI	GAWTC	6 cut(s)	4, 25, 46, 91, 304, 331
Tru1I	TTAA	1 cut(s)	132
Tru9I	TTAA	1 cut(s)	132
TseFI	GTSAC	1 cut(s)	10
Tsp45I	GTSAC	1 cut(s)	10
TspDTI	ATGAA	3 cut(s)	156, 183, 312
Tth111I	GACNNNGTC	1 cut(s)	254
VpaK11BI	GGWCC	1 cut(s)	256
XapI	RAATTY	2 cut(s)	62, 433
XmiI	GTMKAC	1 cut(s)	237
XspI	CTAG	2 cut(s)	183, 188

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.