Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000385.1

Orthogroup ID

OG0008724

Physical Location & Seq

Genomic Coordinates Forward (+)

15694 .. 18299

Gene Structure 2606 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000385.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1881 bp

atgaagtttatgaaaattgggaccaagccggataccttctacactgaacgagctaccaggtctgtagtttcagatgtacccagcgaccttctcatacaaatcaacagcatcagttatgttctccataagtttccattgcttccaaaatgcggtctcttacaacggctttgctgtgattctggtgatctggaaaaaatgaacatagagcttcacgacattccaggaggcgaagaagcttttgaactgtgtgctaagttctgttatggaattaaaataaaactcagtgcctataactttttacctgcatattgtgctgctaaattccttgaaatgactgaatctgtagacaagggaaattttgtcctaaaactcgaggctttcctcaattcatgcattctcgaaggttggaaagactccatcgtcacactacaaactactgttaagttgcctgactggtctgagaatcttggaatcatcagaaagtgcatcgattcaattgttgaaaaaatccttacacccccaccacaggtgacatggtcatacacttataccagacctggttacaacaaaaagcatcatcattctgtccccaaggattggtggacagaggatatatcagaccttgatatagacctgtttcggtgtatagttactgctgttagatcaacctatatgctgccaccacagctcattggggaggctttgcacgtctatgcatgtcgttggctaccagacaccacaaacattagacctcctctggatcaaaatagcgattataatcatgatcaaacattaatggaaaagaatcgaaggattgttgataccattgctagtatgattcctggagataagggatcggtttcagttggtttcttgctaaggcttcttgttattgcaaattatctaggaggagtgtccccagtgacaaagacagaactcttgaggagatccagtctacaacttgaagaggcaaccgtgaatgacctgctttttccttcacactcacccactgaccctgaattttatgatattgacttggtgttggcactcttgcaaagtttcttggtgatatggagaagacaatcccctgcagcagctgcagaaaacagccaccactttttcaggacaataagaaaggttgggaagatcattgattcttaccttcaagtcgttgcacgggatgccaacatgccagtatcaaaagtggcaactcttgctgaagctttgccagatttggctagggaagaccatgatgacatctacaaggctattaacatttatttaaaggagcactctgatctgagcaaggcagataagaagcgcttgtgccgcattttagactgccagaagttgtcgccagaggtacgtgctcatgctgtcaaaaatgagaggctaccattgaggattgttgtgcaagtcctcttctttgagcaagagagaggttccaactctaaggcagcagcgacatctcatagactaccgggccagctggagcaactttgcagctcaggaaaacaaacatcaactgccagcaggggtgaagatcacgcagctaagctaagattgggtggagatgatgaaaaactcagtaggggggagggcacgagaagaaccaataatgccgtttctgaaaccacgaatgctactggaaagagagatatttatgagcaaaggaaaagatcagaagcaaagtctgcagtggaattcacggaaagaagggctgtgaataggggtgaaatacaagtggaagaagtaaatatggcaagagaaatcagggagctgggaatattgtcagctgggagcaagttggacgccagcaagatgatacaaaagggaagtagatcatcagaccatggccgcgacaaagccaaagacagatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BTB NPH3

Protein Analysis

626

Amino Acids

70.58

Weight (kDa)

8.27

Isoelectric Point (pI)

46.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008724)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G47800 AT5G47800 AT5G47800 AT5G47800
fragaria_vesca	FvH4_3g00220 FvH4_3g00220 FvH4_3g00220
malus_domestica	MD05G1363200.v1.1 MD10G1340700.v1.1
prunus_persica	Prupe.4G002400_v2.0.a1 Prupe.4G002400_v2.0.a1
pyrus_communis	pycom05g32950 pycom10g29040
rosa_chinensis	RchiOBHm_Chr5g0000301
rosa_laevigata	RLG00000030857
rosa_multiflora	Rmu_ssc0000385.1_g000006
rosa_roxburghii	Rroxscaffold_1G00075820
rosa_rugosa	Rorug04G0383000
rosa_samantha	Rh5AG002200 Rh5BG003600 Rh5CG002500 Rh5DG002500
rosa_wichuraiana	Rw5G000270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	777
AasI	GACNNNNNNGTC	1 cut(s)	419
Acc36I	ACCTGC	2 cut(s)	310, 993
AccB7I	CCANNNNNTGG	1 cut(s)	597
AccI	GTMKAC	2 cut(s)	345, 955
AccII	CGCG	1 cut(s)	1860
AciI	CCGC	3 cut(s)	150, 1330, 1858
AclWI	GGATC	3 cut(s)	768, 862, 942
AcoI	YGGCCR	1 cut(s)	1855
AcsI	RAATTY	4 cut(s)	320, 355, 1019, 1703
AcuI	CTGAAG	1 cut(s)	1239
AcyI	GRCGYC	1 cut(s)	1812
AfaI	GTAC	2 cut(s)	78, 1365
AfeI	AGCGCT	1 cut(s)	1322
AfiI	CCNNNNNNNGG	3 cut(s)	149, 526, 597
AgsI	TTSAA	6 cut(s)	242, 329, 495, 503, 965, 1166
AjiI	CACGTC	1 cut(s)	709
AjnI	CCWGG	4 cut(s)	56, 220, 556, 841
Alw21I	GWGCWC	2 cut(s)	1293, 1372
Alw26I	GTCTC	1 cut(s)	158
AlwI	GGATC	3 cut(s)	768, 862, 942
AlwNI	CAGNNNCTG	1 cut(s)	1097
Ama87I	CYCGRG	1 cut(s)	371
Aor51HI	AGCGCT	1 cut(s)	1322
AoxI	GGCC	2 cut(s)	1483, 1855
ApeKI	GCWGC	9 cut(s)	314, 676, 1091, 1094, 1097, 1457, 1460, 1503, 1550
ApoI	RAATTY	4 cut(s)	320, 355, 1019, 1703
AseI	ATTAAT	1 cut(s)	794
AspLEI	GCGC	1 cut(s)	1323
AspS9I	GGNCC	2 cut(s)	21, 1483
AsuC2I	CCSGG	1 cut(s)	1482
AsuHPI	GGTGA	6 cut(s)	194, 541, 996, 1078, 1550, 1745
AvaI	CYCGRG	1 cut(s)	371
AvaII	GGWCC	1 cut(s)	21
BaeGI	GKGCMC	1 cut(s)	1604
BauI	CACGAG	1 cut(s)	1603
BbsI	GAAGAC	2 cut(s)	1084, 1251
Bbv12I	GWGCWC	2 cut(s)	1293, 1372
BbvI	GCAGC	9 cut(s)	301, 663, 1084, 1103, 1106, 1469, 1472, 1515, 1562
BccI	CCATC	1 cut(s)	425
BceAI	ACGGC	2 cut(s)	179, 1607
BciT130I	CCWGG	4 cut(s)	58, 222, 558, 843
BciVI	GTATCC	1 cut(s)	25
BclI	TGATCA	1 cut(s)	784
BcnI	CCSGG	1 cut(s)	1482
BcoDI	GTCTC	1 cut(s)	158
BfaI	CTAG	3 cut(s)	831, 905, 1239
BfmI	CTRYAG	5 cut(s)	63, 342, 1089, 1098, 1695
BfoI	RGCGCY	1 cut(s)	1324
BfuAI	ACCTGC	2 cut(s)	310, 993
BfuI	GTATCC	1 cut(s)	25
BlpI	GCTNAGC	1 cut(s)	1554
Bme1390I	CCNGG	5 cut(s)	58, 222, 558, 843, 1482
Bme18I	GGWCC	1 cut(s)	21
BmeT110I	CYCGRG	1 cut(s)	371
BmgBI	CACGTC	1 cut(s)	709
BmgT120I	GGNCC	2 cut(s)	21, 1483
BmiI	GGNNCC	2 cut(s)	22, 1444
BmrFI	CCNGG	5 cut(s)	58, 222, 558, 843, 1482
BmrI	ACTGGG	1 cut(s)	914
BmsI	GCATC	4 cut(s)	117, 495, 583, 1171
BmuI	ACTGGG	1 cut(s)	914
BpiI	GAAGAC	2 cut(s)	1084, 1251
BpmI	CTGGAG	2 cut(s)	864, 1511
Bpu10I	CCTNAGC	2 cut(s)	878, 1507
Bpu1102I	GCTNAGC	1 cut(s)	1554
BpuEI	CTTGAG	1 cut(s)	961
BpuMI	CCSGG	1 cut(s)	1482
Bsa29I	ATCGAT	1 cut(s)	489
BsaAI	YACGTR	1 cut(s)	1367
BsaBI	GATNNNNATC	1 cut(s)	777
BsaHI	GRCGYC	1 cut(s)	1812
BsaI	GGTCTC	1 cut(s)	158
BsaJI	CCNNGG	2 cut(s)	591, 1852
BsaXI	ACNNNNNCTCC	2 cut(s)	937, 967
Bsc4I	CCNNNNNNNGG	3 cut(s)	149, 526, 597
Bse1I	ACTGG	5 cut(s)	458, 920, 951, 1193, 1651
Bse3DI	GCAATG	2 cut(s)	134, 825
Bse8I	GATNNNNATC	1 cut(s)	777
BseBI	CCWGG	4 cut(s)	58, 222, 558, 843
BseCI	ATCGAT	1 cut(s)	489
BseDI	CCNNGG	2 cut(s)	591, 1852
BseGI	GGATG	1 cut(s)	1186
BseJI	GATNNNNATC	1 cut(s)	777
BseLI	CCNNNNNNNGG	3 cut(s)	149, 526, 597
BseMI	GCAATG	2 cut(s)	134, 825
BseMII	CTCAG	5 cut(s)	295, 450, 1292, 1521, 1600
BseNI	ACTGG	5 cut(s)	458, 920, 951, 1193, 1651
BseRI	GAGGAG	3 cut(s)	744, 924, 958
BseSI	GKGCMC	1 cut(s)	1604
BseXI	GCAGC	9 cut(s)	301, 663, 1084, 1103, 1106, 1469, 1472, 1515, 1562
BseYI	CCCAGC	3 cut(s)	80, 1780, 1796
Bsh1236I	CGCG	1 cut(s)	1860
BshFI	GGCC	2 cut(s)	1485, 1857
BshVI	ATCGAT	1 cut(s)	489
BsiHKAI	GWGCWC	2 cut(s)	1293, 1372
BsiHKCI	CYCGRG	1 cut(s)	371
BsiSI	CCGG	2 cut(s)	29, 1481
BslFI	GGGAC	3 cut(s)	34, 572, 901
BslI	CCNNNNNNNGG	3 cut(s)	149, 526, 597
BsmAI	GTCTC	1 cut(s)	158
BsmFI	GGGAC	3 cut(s)	34, 572, 901
BsmI	GAATGC	2 cut(s)	393, 1645
BsnI	GGCC	2 cut(s)	1485, 1857
Bso31I	GGTCTC	1 cut(s)	158
BsoBI	CYCGRG	1 cut(s)	371
Bsp1286I	GDGCHC	3 cut(s)	1293, 1372, 1604
Bsp1720I	GCTNAGC	1 cut(s)	1554
Bsp19I	CCATGG	1 cut(s)	1852
BspACI	CCGC	3 cut(s)	150, 1330, 1858
BspANI	GGCC	2 cut(s)	1485, 1857
BspCNI	CTCAG	5 cut(s)	294, 451, 1293, 1520, 1599
BspDI	ATCGAT	1 cut(s)	489
BspFNI	CGCG	1 cut(s)	1860
BspHI	TCATGA	1 cut(s)	781
BspLI	GGNNCC	2 cut(s)	22, 1444
BspMAI	CTGCAG	3 cut(s)	1093, 1102, 1699
BspMI	ACCTGC	2 cut(s)	310, 993
BspPI	GGATC	3 cut(s)	768, 862, 942
BspTNI	GGTCTC	1 cut(s)	158
BsrDI	GCAATG	2 cut(s)	134, 825
BsrI	ACTGG	5 cut(s)	458, 920, 951, 1193, 1651
BssECI	CCNNGG	2 cut(s)	591, 1852
BssNI	GRCGYC	1 cut(s)	1812
BssSI	CACGAG	1 cut(s)	1603
BssT1I	CCWWGG	2 cut(s)	591, 1852
Bst2BI	CACGAG	1 cut(s)	1603
Bst2UI	CCWGG	4 cut(s)	58, 222, 558, 843
Bst4CI	ACNGT	3 cut(s)	246, 439, 976
Bst6I	CTCTTC	2 cut(s)	960, 1427
BstACI	GRCGYC	1 cut(s)	1812
BstAPI	GCANNNNNTGC	5 cut(s)	311, 1097, 1181, 1214, 1694
BstBAI	YACGTR	1 cut(s)	1367
BstC8I	GCNNGC	3 cut(s)	1487, 1531, 1816
BstDSI	CCRYGG	1 cut(s)	1852
BstF5I	GGATG	1 cut(s)	1186
BstFNI	CGCG	1 cut(s)	1860
BstH2I	RGCGCY	1 cut(s)	1324
BstHHI	GCGC	1 cut(s)	1323
BstMAI	GTCTC	1 cut(s)	158
BstMWI	GCNNNNNNNGC	7 cut(s)	311, 685, 1097, 1181, 1214, 1329, 1694
BstNI	CCWGG	4 cut(s)	58, 222, 558, 843
BstNSI	RCATGY	2 cut(s)	720, 1192
BstSCI	CCNGG	5 cut(s)	56, 220, 556, 841, 1480
BstSFI	CTRYAG	5 cut(s)	63, 342, 1089, 1098, 1695
BstSLI	GKGCMC	1 cut(s)	1604
BstUI	CGCG	1 cut(s)	1860
BstV1I	GCAGC	9 cut(s)	301, 663, 1084, 1103, 1106, 1469, 1472, 1515, 1562
BstV2I	GAAGAC	2 cut(s)	1084, 1251
BstX2I	RGATCY	1 cut(s)	947
BstYI	RGATCY	1 cut(s)	947
Bsu15I	ATCGAT	1 cut(s)	489
BsuI	GTATCC	1 cut(s)	25
BsuRI	GGCC	2 cut(s)	1485, 1857
BsuTUI	ATCGAT	1 cut(s)	489
BtgI	CCRYGG	1 cut(s)	1852
BtrI	CACGTC	1 cut(s)	709
BtsCI	GGATG	1 cut(s)	1186
BtsI	GCAGTG	1 cut(s)	1704
BtsIMutI	CAGTG	5 cut(s)	42, 289, 927, 1008, 1704
BveI	ACCTGC	2 cut(s)	310, 993
Cac8I	GCNNGC	3 cut(s)	1487, 1531, 1816
CaiI	CAGNNNCTG	1 cut(s)	1097
CciI	TCATGA	1 cut(s)	781
CfoI	GCGC	1 cut(s)	1323
Cfr13I	GGNCC	2 cut(s)	21, 1483
ClaI	ATCGAT	1 cut(s)	489
CseI	GACGC	1 cut(s)	1820
CsiI	ACCWGGT	2 cut(s)	56, 556
Csp6I	GTAC	2 cut(s)	77, 1364
CviAII	CATG	8 cut(s)	390, 534, 717, 782, 1189, 1250, 1373, 1853
CviQI	GTAC	2 cut(s)	77, 1364
DraI	TTTAAA	1 cut(s)	1284
DrdI	GACNNNNNNGTC	1 cut(s)	419
DseDI	GACNNNNNNGTC	1 cut(s)	419
EaeI	YGGCCR	1 cut(s)	1855
Eam1104I	CTCTTC	2 cut(s)	960, 1427
EarI	CTCTTC	2 cut(s)	960, 1427
Eco130I	CCWWGG	2 cut(s)	591, 1852
Eco31I	GGTCTC	1 cut(s)	158
Eco47I	GGWCC	1 cut(s)	21
Eco47III	AGCGCT	1 cut(s)	1322
Eco57I	CTGAAG	1 cut(s)	1239
Eco88I	CYCGRG	1 cut(s)	371
EcoRI	GAATTC	1 cut(s)	1703
EcoRII	CCWGG	4 cut(s)	56, 220, 556, 841
EcoT14I	CCWWGG	2 cut(s)	591, 1852
EcoT22I	ATGCAT	2 cut(s)	395, 718
ErhI	CCWWGG	2 cut(s)	591, 1852
FaeI	CATG	8 cut(s)	393, 537, 720, 785, 1192, 1253, 1376, 1856
FalI	AAGNNNNNCTT	2 cut(s)	1307, 1339
FaqI	GGGAC	3 cut(s)	34, 572, 901
FatI	CATG	8 cut(s)	389, 533, 716, 781, 1188, 1249, 1372, 1852
FbaI	TGATCA	1 cut(s)	784
FblI	GTMKAC	2 cut(s)	345, 955
FokI	GGATG	1 cut(s)	1193
FspBI	CTAG	3 cut(s)	831, 905, 1239
GlaI	GCGC	1 cut(s)	1322
GsaI	CCCAGC	3 cut(s)	84, 1784, 1800
GsuI	CTGGAG	2 cut(s)	864, 1511
HaeII	RGCGCY	1 cut(s)	1324
HaeIII	GGCC	2 cut(s)	1485, 1857
HapII	CCGG	2 cut(s)	29, 1481
HgaI	GACGC	1 cut(s)	1820
HhaI	GCGC	1 cut(s)	1323
Hin1I	GRCGYC	1 cut(s)	1812
Hin1II	CATG	8 cut(s)	393, 537, 720, 785, 1192, 1253, 1376, 1856
Hin6I	GCGC	1 cut(s)	1321
HinP1I	GCGC	1 cut(s)	1321
HindIII	AAGCTT	2 cut(s)	234, 1221
HinfI	GANTC	9 cut(s)	176, 338, 413, 463, 471, 491, 805, 838, 1154
HpaII	CCGG	2 cut(s)	29, 1481
HphI	GGTGA	6 cut(s)	194, 541, 996, 1078, 1550, 1745
Hpy166II	GTNNAC	3 cut(s)	346, 603, 956
Hpy188I	TCNGA	9 cut(s)	73, 460, 479, 619, 1297, 1302, 1630, 1684, 1849
Hpy188III	TCNNGA	8 cut(s)	188, 212, 398, 758, 782, 940, 1123, 1509
Hpy8I	GTNNAC	3 cut(s)	346, 603, 956
HpyAV	CCTTC	7 cut(s)	46, 98, 395, 804, 1005, 1172, 1710
HpyCH4III	ACNGT	3 cut(s)	246, 439, 976
HpyCH4IV	ACGT	2 cut(s)	708, 1366
HpyF10VI	GCNNNNNNNGC	7 cut(s)	311, 685, 1097, 1181, 1214, 1329, 1694
HpySE526I	ACGT	2 cut(s)	708, 1366
Hsp92I	GRCGYC	1 cut(s)	1812
Hsp92II	CATG	8 cut(s)	393, 537, 720, 785, 1192, 1253, 1376, 1856
HspAI	GCGC	1 cut(s)	1321
Ksp22I	TGATCA	1 cut(s)	784
LmnI	GCTCC	4 cut(s)	1288, 1492, 1777, 1800
Lsp1109I	GCAGC	9 cut(s)	301, 663, 1084, 1103, 1106, 1469, 1472, 1515, 1562
LweI	GCATC	4 cut(s)	117, 495, 583, 1171
MabI	ACCWGGT	2 cut(s)	56, 556
MaeI	CTAG	3 cut(s)	831, 905, 1239
MaeII	ACGT	2 cut(s)	708, 1366
MaeIII	GTNAC	5 cut(s)	421, 529, 560, 649, 922
MboII	GAAGA	9 cut(s)	242, 977, 1089, 1156, 1256, 1414, 1553, 1620, 1760
MfeI	CAATTG	1 cut(s)	495
MflI	RGATCY	1 cut(s)	947
MhlI	GDGCHC	3 cut(s)	1293, 1372, 1604
MluCI	AATT	9 cut(s)	15, 267, 320, 355, 385, 495, 898, 1019, 1703
MlyI	GAGTC	1 cut(s)	407
MmeI	TCCRAC	3 cut(s)	386, 1470, 1788
Mph1103I	ATGCAT	2 cut(s)	395, 718
MseI	TTAA	5 cut(s)	270, 441, 794, 1272, 1283
MslI	CAYNNNNRTG	1 cut(s)	711
MspA1I	CMGCKG	3 cut(s)	1097, 1489, 1796
MspI	CCGG	2 cut(s)	29, 1481
MspR9I	CCNGG	5 cut(s)	58, 222, 558, 843, 1482
MunI	CAATTG	1 cut(s)	495
Mva1269I	GAATGC	2 cut(s)	393, 1645
MvaI	CCWGG	4 cut(s)	58, 222, 558, 843
MvnI	CGCG	1 cut(s)	1860
MwoI	GCNNNNNNNGC	7 cut(s)	311, 685, 1097, 1181, 1214, 1329, 1694
NciI	CCSGG	1 cut(s)	1482
NcoI	CCATGG	1 cut(s)	1852
NlaIII	CATG	8 cut(s)	393, 537, 720, 785, 1192, 1253, 1376, 1856
NlaIV	GGNNCC	2 cut(s)	22, 1444
NmuCI	GTSAC	3 cut(s)	421, 529, 922
NsiI	ATGCAT	2 cut(s)	395, 718
NspI	RCATGY	2 cut(s)	720, 1192
PaeR7I	CTCGAG	1 cut(s)	371
PagI	TCATGA	1 cut(s)	781
PctI	GAATGC	2 cut(s)	393, 1645
PfeI	GAWTC	8 cut(s)	176, 338, 463, 471, 491, 805, 838, 1154
PflFI	GACNNNGTC	1 cut(s)	535
PflMI	CCANNNNNTGG	1 cut(s)	597
PfoI	TCCNGGA	2 cut(s)	220, 841
PleI	GAGTC	1 cut(s)	407
PpsI	GAGTC	1 cut(s)	407
Ppu21I	YACGTR	1 cut(s)	1367
PshBI	ATTAAT	1 cut(s)	794
PsiI	TTATAA	1 cut(s)	777
Psp6I	CCWGG	4 cut(s)	56, 220, 556, 841
PspFI	CCCAGC	3 cut(s)	80, 1780, 1796
PspGI	CCWGG	4 cut(s)	56, 220, 556, 841
PspN4I	GGNNCC	2 cut(s)	22, 1444
PspPI	GGNCC	2 cut(s)	21, 1483
PspXI	VCTCGAGB	1 cut(s)	371
PstI	CTGCAG	3 cut(s)	1093, 1102, 1699
PstNI	CAGNNNCTG	1 cut(s)	1097
PsuI	RGATCY	1 cut(s)	947
PsyI	GACNNNGTC	1 cut(s)	535
PvuII	CAGCTG	3 cut(s)	1097, 1489, 1796
RsaI	GTAC	2 cut(s)	78, 1365
RsaNI	GTAC	2 cut(s)	77, 1364
RseI	CAYNNNNRTG	1 cut(s)	711
SaqAI	TTAA	5 cut(s)	270, 441, 794, 1272, 1283
Sau96I	GGNCC	2 cut(s)	21, 1483
SchI	GAGTC	1 cut(s)	407
ScrFI	CCNGG	5 cut(s)	58, 222, 558, 843, 1482
SduI	GDGCHC	3 cut(s)	1293, 1372, 1604
SexAI	ACCWGGT	2 cut(s)	56, 556
SfaNI	GCATC	4 cut(s)	117, 495, 583, 1171
SfcI	CTRYAG	5 cut(s)	63, 342, 1089, 1098, 1695
Sfr274I	CTCGAG	1 cut(s)	371
SinI	GGWCC	1 cut(s)	21
SlaI	CTCGAG	1 cut(s)	371
SmiMI	CAYNNNNRTG	1 cut(s)	711
SmlI	CTYRAG	2 cut(s)	371, 940
SmoI	CTYRAG	2 cut(s)	371, 940
Sse9I	AATT	9 cut(s)	15, 267, 320, 355, 385, 495, 898, 1019, 1703
SsiI	CCGC	3 cut(s)	150, 1330, 1858
SspI	AATATT	1 cut(s)	1788
SspMI	CTAG	3 cut(s)	831, 905, 1239
StyD4I	CCNGG	5 cut(s)	56, 220, 556, 841, 1480
StyI	CCWWGG	2 cut(s)	591, 1852
TaaI	ACNGT	3 cut(s)	246, 439, 976
TaiI	ACGT	2 cut(s)	711, 1369
TaqI	TCGA	4 cut(s)	372, 399, 489, 808
TasI	AATT	9 cut(s)	15, 267, 320, 355, 385, 495, 898, 1019, 1703
TauI	GCSGC	2 cut(s)	1332, 1860
TfiI	GAWTC	8 cut(s)	176, 338, 463, 471, 491, 805, 838, 1154
Tru1I	TTAA	5 cut(s)	270, 441, 794, 1272, 1283
Tru9I	TTAA	5 cut(s)	270, 441, 794, 1272, 1283
TscAI	CASTG	5 cut(s)	49, 289, 927, 1015, 1704
TseFI	GTSAC	3 cut(s)	421, 529, 922
TseI	GCWGC	9 cut(s)	314, 676, 1091, 1094, 1097, 1457, 1460, 1503, 1550
Tsp45I	GTSAC	3 cut(s)	421, 529, 922
TspDTI	ATGAA	5 cut(s)	17, 26, 212, 378, 1593
TspGWI	ACGGA	1 cut(s)	1724
TspRI	CASTG	5 cut(s)	49, 289, 927, 1015, 1704
Tth111I	GACNNNGTC	1 cut(s)	535
Van91I	CCANNNNNTGG	1 cut(s)	597
VpaK11BI	GGWCC	1 cut(s)	21
VspI	ATTAAT	1 cut(s)	794
XapI	RAATTY	4 cut(s)	320, 355, 1019, 1703
XceI	RCATGY	2 cut(s)	720, 1192
XcmI	CCANNNNNNNNNTGG	1 cut(s)	531
XhoI	CTCGAG	1 cut(s)	371
XmiI	GTMKAC	2 cut(s)	345, 955
XspI	CTAG	3 cut(s)	831, 905, 1239
Zsp2I	ATGCAT	2 cut(s)	395, 718

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.