Rmu_ssc0000473.1_g000006

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000473.1
OG0017316
Physical Location & Seq
Forward (+)
49700 .. 50332
633 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000473.1_g000006.1.cds

Sequence Viewer

Length: 633 bp
atgatcatcacacggaaaacaaagcctacaacgacaagtagaagtggtgttgtgtccccacttcctcttgtgagatcagcaaagaatattccagctgtcttttctaatgagaaaccgcctaatctgaggacagagcaacgctcaatatccgctacacgggatcgatcagctcgggccaaatcagctgcagcacctgtaagtactcacctgcagagatcagcatacacagctgaaccaaggaggccacaatcatgctcatcaatagcaagcatctctagggatcggaaagtaatcagtagtaatgttgaagggagcgtgcagctggatatcaagtactgtactgtcagtgaaggcgatttgatcaataccagtagtccaaacggaataagaagtaatcaaacaggaaacggggggcaaattttggggagtaggatggtccagagagtcatgagtgcaagatcaaaggcagctactcttgaagagaaaaataagagaccaaattctcggtttccgcttaatgaaacctctggatttggtagaatgattcccaagaattcaatggatacaactctcaagcatatggtatggttctttcttcttcatgctttccctttcatatcttcgtttgcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00562 map00562
Pfam Domains
Protein Families
No domains found.

Protein Analysis

210

Amino Acids

23.05

Weight (kDa)

11.21

Isoelectric Point (pI)

62.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017316)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g00040
prunus_persica Prupe.6G365700_v2.0.a1
pyrus_communis pycom12g24270
rosa_laevigata RLG00000026006
rosa_multiflora Rmu_ssc0000473.1_g000006
rosa_roxburghii Rroxscaffold_6G00425540
rosa_rugosa Rorug02G0600400 Rorug02G0600500
rosa_samantha Rh3AG000600 Rh3BG000400 Rh3CG000400 Rh3DG000600
rosa_wichuraiana Rw3G000040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 216
Acc36I ACCTGC 1 cut(s) 216
AciI CCGC 3 cut(s) 116, 150, 512
AclWI GGATC 2 cut(s) 168, 288
AcsI RAATTY 3 cut(s) 417, 499, 553
AfaI GTAC 3 cut(s) 202, 335, 340
AfiI CCNNNNNNNGG 1 cut(s) 156
AgsI TTSAA 3 cut(s) 308, 479, 558
AluBI AGCT 6 cut(s) 95, 170, 185, 230, 322, 470
AluI AGCT 6 cut(s) 95, 170, 185, 230, 322, 470
Alw26I GTCTC 1 cut(s) 487
AlwI GGATC 2 cut(s) 168, 288
AlwNI CAGNNNCTG 1 cut(s) 194
Ama87I CYCGRG 1 cut(s) 171
AoxI GGCC 2 cut(s) 174, 242
ApeKI GCWGC 4 cut(s) 185, 188, 319, 467
ApoI RAATTY 3 cut(s) 417, 499, 553
AspS9I GGNCC 2 cut(s) 174, 436
AsuHPI GGTGA 1 cut(s) 197
AvaI CYCGRG 1 cut(s) 171
AvaII GGWCC 1 cut(s) 436
BbvI GCAGC 4 cut(s) 172, 200, 331, 479
BccI CCATC 1 cut(s) 427
BciVI GTATCC 1 cut(s) 556
BclI TGATCA 2 cut(s) 3, 360
BcoDI GTCTC 1 cut(s) 487
BfaI CTAG 1 cut(s) 276
BfmI CTRYAG 2 cut(s) 186, 209
BfuAI ACCTGC 1 cut(s) 216
BfuI GTATCC 1 cut(s) 556
BisI GCNGC 4 cut(s) 186, 189, 320, 468
BlsI GCNGC 4 cut(s) 187, 190, 321, 469
BmcAI AGTACT 2 cut(s) 202, 335
Bme18I GGWCC 1 cut(s) 436
BmeT110I CYCGRG 1 cut(s) 171
BmgT120I GGNCC 2 cut(s) 174, 436
BmsI GCATC 1 cut(s) 279
BplI GAGNNNNNCTC 2 cut(s) 125, 157
BpuEI CTTGAG 1 cut(s) 557
Bsa29I ATCGAT 1 cut(s) 163
BsaI GGTCTC 1 cut(s) 487
BsaJI CCNNGG 1 cut(s) 236
Bsc4I CCNNNNNNNGG 1 cut(s) 156
Bse1I ACTGG 1 cut(s) 369
BseCI ATCGAT 1 cut(s) 163
BseDI CCNNGG 1 cut(s) 236
BseGI GGATG 1 cut(s) 438
BseLI CCNNNNNNNGG 1 cut(s) 156
BseMII CTCAG 1 cut(s) 116
BseNI ACTGG 1 cut(s) 369
BseXI GCAGC 4 cut(s) 172, 200, 331, 479
BsgI GTGCAG 1 cut(s) 338
BshFI GGCC 2 cut(s) 176, 244
BshVI ATCGAT 1 cut(s) 163
BsiHKCI CYCGRG 1 cut(s) 171
BslFI GGGAC 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 156
BsmAI GTCTC 1 cut(s) 487
BsmFI GGGAC 1 cut(s) 40
BsnI GGCC 2 cut(s) 176, 244
Bso31I GGTCTC 1 cut(s) 487
BsoBI CYCGRG 1 cut(s) 171
Bsp143I GATC 8 cut(s) 3, 74, 160, 164, 215, 280, 360, 458
BspACI CCGC 3 cut(s) 116, 150, 512
BspANI GGCC 2 cut(s) 176, 244
BspCNI CTCAG 1 cut(s) 117
BspDI ATCGAT 1 cut(s) 163
BspHI TCATGA 1 cut(s) 447
BspMAI CTGCAG 2 cut(s) 190, 213
BspMI ACCTGC 1 cut(s) 216
BspPI GGATC 2 cut(s) 168, 288
BspTNI GGTCTC 1 cut(s) 487
BsrI ACTGG 1 cut(s) 369
BssECI CCNNGG 1 cut(s) 236
BssMI GATC 8 cut(s) 3, 74, 160, 164, 215, 280, 360, 458
BssT1I CCWWGG 1 cut(s) 236
Bst4CI ACNGT 2 cut(s) 338, 343
Bst6I CTCTTC 1 cut(s) 474
BstC8I GCNNGC 2 cut(s) 268, 317
BstDEI CTNAG 1 cut(s) 125
BstF5I GGATG 1 cut(s) 438
BstKTI GATC 8 cut(s) 6, 77, 163, 167, 218, 283, 363, 461
BstMAI GTCTC 1 cut(s) 487
BstMBI GATC 8 cut(s) 3, 74, 160, 164, 215, 280, 360, 458
BstMWI GCNNNNNNNGC 2 cut(s) 182, 227
BstSFI CTRYAG 2 cut(s) 186, 209
BstV1I GCAGC 4 cut(s) 172, 200, 331, 479
Bsu15I ATCGAT 1 cut(s) 163
BsuI GTATCC 1 cut(s) 556
BsuRI GGCC 2 cut(s) 176, 244
BsuTUI ATCGAT 1 cut(s) 163
BtsCI GGATG 1 cut(s) 438
BtsIMutI CAGTG 1 cut(s) 352
BveI ACCTGC 1 cut(s) 216
Cac8I GCNNGC 2 cut(s) 268, 317
CaiI CAGNNNCTG 1 cut(s) 194
CciI TCATGA 1 cut(s) 447
Cfr13I GGNCC 2 cut(s) 174, 436
ClaI ATCGAT 1 cut(s) 163
Csp6I GTAC 3 cut(s) 201, 334, 339
CviAII CATG 4 cut(s) 252, 448, 602, 630
CviJI RGCY 9 cut(s) 25, 95, 170, 176, 185, 230, 244, 322, 470
CviKI_1 RGCY 9 cut(s) 25, 95, 170, 176, 185, 230, 244, 322, 470
CviQI GTAC 3 cut(s) 201, 334, 339
DdeI CTNAG 1 cut(s) 125
DpnI GATC 8 cut(s) 5, 76, 162, 166, 217, 282, 362, 460
DpnII GATC 8 cut(s) 3, 74, 160, 164, 215, 280, 360, 458
Eam1104I CTCTTC 1 cut(s) 474
EarI CTCTTC 1 cut(s) 474
Eco130I CCWWGG 1 cut(s) 236
Eco31I GGTCTC 1 cut(s) 487
Eco32I GATATC 1 cut(s) 328
Eco47I GGWCC 1 cut(s) 436
Eco88I CYCGRG 1 cut(s) 171
EcoRI GAATTC 1 cut(s) 553
EcoRV GATATC 1 cut(s) 328
EcoT14I CCWWGG 1 cut(s) 236
ErhI CCWWGG 1 cut(s) 236
FaeI CATG 4 cut(s) 255, 451, 605, 633
FaiI YATR 9 cut(s) 223, 253, 449, 579, 581, 586, 603, 617, 631
FaqI GGGAC 1 cut(s) 40
FatI CATG 4 cut(s) 251, 447, 601, 629
FauNDI CATATG 1 cut(s) 579
FbaI TGATCA 2 cut(s) 3, 360
Fnu4HI GCNGC 4 cut(s) 186, 189, 320, 468
FokI GGATG 1 cut(s) 445
Fsp4HI GCNGC 4 cut(s) 186, 189, 320, 468
FspBI CTAG 1 cut(s) 276
GluI GCNGC 4 cut(s) 186, 189, 320, 468
HaeIII GGCC 2 cut(s) 176, 244
Hin1II CATG 4 cut(s) 255, 451, 605, 633
HinfI GANTC 2 cut(s) 444, 544
HphI GGTGA 1 cut(s) 197
Hpy188I TCNGA 2 cut(s) 126, 285
Hpy188III TCNNGA 4 cut(s) 439, 448, 476, 528
HpyAV CCTTC 2 cut(s) 302, 344
HpyCH4III ACNGT 2 cut(s) 338, 343
HpyCH4V TGCA 5 cut(s) 188, 211, 319, 455, 629
HpyF10VI GCNNNNNNNGC 2 cut(s) 182, 227
HpyF3I CTNAG 1 cut(s) 125
Hsp92II CATG 4 cut(s) 255, 451, 605, 633
Ksp22I TGATCA 2 cut(s) 3, 360
Kzo9I GATC 8 cut(s) 3, 74, 160, 164, 215, 280, 360, 458
LmnI GCTCC 1 cut(s) 312
LpnPI CCDG 8 cut(s) 105, 207, 221, 308, 382, 387, 452, 513
Lsp1109I GCAGC 4 cut(s) 172, 200, 331, 479
LweI GCATC 1 cut(s) 279
MaeI CTAG 1 cut(s) 276
MalI GATC 8 cut(s) 5, 76, 162, 166, 217, 282, 362, 460
MboI GATC 8 cut(s) 3, 74, 160, 164, 215, 280, 360, 458
MboII GAAGA 4 cut(s) 491, 587, 590, 612
MluCI AATT 3 cut(s) 417, 499, 553
MlyI GAGTC 1 cut(s) 453
MnlI CCTC 4 cut(s) 75, 120, 234, 535
MseI TTAA 1 cut(s) 516
MslI CAYNNNNRTG 1 cut(s) 250
MspA1I CMGCKG 4 cut(s) 95, 185, 230, 322
MwoI GCNNNNNNNGC 2 cut(s) 182, 227
NdeI CATATG 1 cut(s) 579
NdeII GATC 8 cut(s) 3, 74, 160, 164, 215, 280, 360, 458
NlaIII CATG 4 cut(s) 255, 451, 605, 633
PagI TCATGA 1 cut(s) 447
PaqCI CACCTGC 1 cut(s) 216
PfeI GAWTC 1 cut(s) 544
PkrI GCNGC 4 cut(s) 187, 190, 321, 469
PleI GAGTC 1 cut(s) 452
PpsI GAGTC 1 cut(s) 452
PspPI GGNCC 2 cut(s) 174, 436
PstI CTGCAG 2 cut(s) 190, 213
PstNI CAGNNNCTG 1 cut(s) 194
PvuII CAGCTG 4 cut(s) 95, 185, 230, 322
RsaI GTAC 3 cut(s) 202, 335, 340
RsaNI GTAC 3 cut(s) 201, 334, 339
RseI CAYNNNNRTG 1 cut(s) 250
SaqAI TTAA 1 cut(s) 516
SatI GCNGC 4 cut(s) 186, 189, 320, 468
Sau3AI GATC 8 cut(s) 3, 74, 160, 164, 215, 280, 360, 458
Sau96I GGNCC 2 cut(s) 174, 436
ScaI AGTACT 2 cut(s) 202, 335
SchI GAGTC 1 cut(s) 453
SetI ASST 9 cut(s) 97, 172, 187, 196, 210, 232, 324, 472, 527
SfaNI GCATC 1 cut(s) 279
SfcI CTRYAG 2 cut(s) 186, 209
SinI GGWCC 1 cut(s) 436
SmiMI CAYNNNNRTG 1 cut(s) 250
SmlI CTYRAG 1 cut(s) 572
SmoI CTYRAG 1 cut(s) 572
Sse9I AATT 3 cut(s) 417, 499, 553
SsiI CCGC 3 cut(s) 116, 150, 512
SspI AATATT 1 cut(s) 88
SspMI CTAG 1 cut(s) 276
StyI CCWWGG 1 cut(s) 236
TaaI ACNGT 2 cut(s) 338, 343
TaqI TCGA 1 cut(s) 163
TasI AATT 3 cut(s) 417, 499, 553
TatI WGTACW 3 cut(s) 200, 333, 338
TfiI GAWTC 1 cut(s) 544
Tru1I TTAA 1 cut(s) 516
Tru9I TTAA 1 cut(s) 516
TscAI CASTG 1 cut(s) 352
TseI GCWGC 4 cut(s) 185, 188, 319, 467
TspDTI ATGAA 3 cut(s) 534, 590, 604
TspGWI ACGGA 2 cut(s) 28, 396
TspRI CASTG 1 cut(s) 352
VpaK11BI GGWCC 1 cut(s) 436
XapI RAATTY 3 cut(s) 417, 499, 553
XcmI CCANNNNNNNNNTGG 1 cut(s) 556
XspI CTAG 1 cut(s) 276
ZrmI AGTACT 2 cut(s) 202, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.