Rroxscaffold_165G00436970

DENN domain and WD repeat-containing protein SCD1

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000165
Physical Location & Seq
Forward (+)
73546 .. 76717
3172 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_165G00436970.1

Sequence Viewer

Length: 192 bp
ATGTCCAGAAATGATTGGATGACTATCAGAGATGCCCTTGAGGTGTCTGCTGAAATGTTTAAGAAGGATGGAAATAATGTTTCAGATTATGTTCAGCGTCATCTTATATCTTTGTCCATTTGGGAGGAATTACGTTTCTGGGAAAGCTACTTTGACTGTCTAATGGAACGGTCTTCAAACAAGACCCAGTAA

Protein Analysis

63

Amino Acids

7.64

Weight (kDa)

4.94

Isoelectric Point (pI)

53.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019012)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 177
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
BbsI GAAGAC 1 cut(s) 165
BccI CCATC 1 cut(s) 62
BmrI ACTGGG 1 cut(s) 181
BmsI GCATC 1 cut(s) 22
BmuI ACTGGG 1 cut(s) 181
BpiI GAAGAC 1 cut(s) 165
BpuEI CTTGAG 1 cut(s) 59
BsaBI GATNNNNATC 1 cut(s) 23
Bse1I ACTGG 1 cut(s) 187
Bse8I GATNNNNATC 1 cut(s) 23
BseGI GGATG 2 cut(s) 24, 73
BseJI GATNNNNATC 1 cut(s) 23
BseNI ACTGG 1 cut(s) 187
BsrI ACTGG 1 cut(s) 187
Bst4CI ACNGT 2 cut(s) 158, 171
BstF5I GGATG 2 cut(s) 24, 73
BstV2I GAAGAC 1 cut(s) 165
BtsCI GGATG 2 cut(s) 24, 73
CseI GACGC 1 cut(s) 86
CviJI RGCY 1 cut(s) 147
CviKI_1 RGCY 1 cut(s) 147
FaiI YATR 2 cut(s) 90, 107
FokI GGATG 2 cut(s) 31, 80
HgaI GACGC 1 cut(s) 86
Hpy188I TCNGA 2 cut(s) 29, 85
Hpy188III TCNNGA 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 58
HpyCH4III ACNGT 2 cut(s) 158, 171
HpyCH4IV ACGT 1 cut(s) 133
HpySE526I ACGT 1 cut(s) 133
LpnPI CCDG 2 cut(s) 19, 124
LweI GCATC 1 cut(s) 22
MaeII ACGT 1 cut(s) 133
MboII GAAGA 1 cut(s) 165
MluCI AATT 1 cut(s) 128
MnlI CCTC 2 cut(s) 34, 118
MseI TTAA 1 cut(s) 60
SaqAI TTAA 1 cut(s) 60
SetI ASST 3 cut(s) 45, 136, 149
SfaNI GCATC 1 cut(s) 22
SgeI CNNG 3 cut(s) 18, 50, 151
SmlI CTYRAG 1 cut(s) 38
SmoI CTYRAG 1 cut(s) 38
Sse9I AATT 1 cut(s) 128
TaaI ACNGT 2 cut(s) 158, 171
TaiI ACGT 1 cut(s) 136
TasI AATT 1 cut(s) 128
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.