Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0019012

Physical Location & Seq

Genomic Coordinates Forward (+)

4184603 .. 4187638

Gene Structure 3036 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00003450.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGTCCAGAAATGATTGGATGACTATCAGAGATGCCCTTGAGGTGTCTGATGAAATGTTTAAGAAGGATGGAAATAATGTTTCAGATTATGTTCAGCGTCATCTTATATCTTTGTCCATTTGGGAGGAATTACGTTTCTGGGAAAGCTACTTTGACTGTCTAATGGAACGGTCTTCAAACAATGCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0000278 GO:0000281 GO:0000910 GO:0000911 GO:0002682 GO:0002683 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005886 GO:0007049 GO:0007275 GO:0008150 GO:0009791 GO:0009825 GO:0009888 GO:0009987 GO:0010235 GO:0010374 GO:0010440 GO:0016020 GO:0016049 GO:0022402 GO:0030135 GO:0030136 GO:0031347 GO:0031348 GO:0031410 GO:0031461 GO:0031982 GO:0032501 GO:0032502 GO:0032506 GO:0032991 GO:0040007 GO:0043226 GO:0043227 GO:0043229 GO:0044424 GO:0044444 GO:0044464 GO:0045088 GO:0045824 GO:0048519 GO:0048583 GO:0048585 GO:0048856 GO:0048869 GO:0050776 GO:0050777 GO:0050789 GO:0051301 GO:0061640 GO:0065007 GO:0071944 GO:0080008 GO:0080134 GO:0090558 GO:0097708 GO:1902410 GO:1902494 GO:1903047 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DENN WD40 dDENN uDENN

Protein Analysis

62

Amino Acids

7.51

Weight (kDa)

4.57

Isoelectric Point (pI)

51.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019012)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0051881
rosa_multiflora	Rmu_sc0004753.1_g000014
rosa_roxburghii	Rroxscaffold_165G00436970 Rroxscaffold_1G00003450 Rroxscaffold_6G00425400
rosa_samantha	Rh3AG297900 Rh5AG452700 Rh5BG359400
rosa_wichuraiana	Rw3G026290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	177
AluBI	AGCT	1 cut(s)	147
AluI	AGCT	1 cut(s)	147
BbsI	GAAGAC	1 cut(s)	165
BccI	CCATC	1 cut(s)	62
BmsI	GCATC	1 cut(s)	22
BpiI	GAAGAC	1 cut(s)	165
BpuEI	CTTGAG	1 cut(s)	59
BsaBI	GATNNNNATC	1 cut(s)	23
Bse8I	GATNNNNATC	1 cut(s)	23
BseGI	GGATG	2 cut(s)	24, 73
BseJI	GATNNNNATC	1 cut(s)	23
Bst4CI	ACNGT	2 cut(s)	158, 171
BstF5I	GGATG	2 cut(s)	24, 73
BstV2I	GAAGAC	1 cut(s)	165
BtsCI	GGATG	2 cut(s)	24, 73
CseI	GACGC	1 cut(s)	86
CviJI	RGCY	1 cut(s)	147
CviKI_1	RGCY	1 cut(s)	147
FaiI	YATR	2 cut(s)	90, 107
FokI	GGATG	2 cut(s)	31, 80
HgaI	GACGC	1 cut(s)	86
Hpy188I	TCNGA	3 cut(s)	29, 49, 85
Hpy188III	TCNNGA	1 cut(s)	6
HpyAV	CCTTC	1 cut(s)	58
HpyCH4III	ACNGT	2 cut(s)	158, 171
HpyCH4IV	ACGT	1 cut(s)	133
HpySE526I	ACGT	1 cut(s)	133
LpnPI	CCDG	2 cut(s)	19, 124
LweI	GCATC	1 cut(s)	22
MaeII	ACGT	1 cut(s)	133
MboII	GAAGA	1 cut(s)	165
MluCI	AATT	1 cut(s)	128
MnlI	CCTC	2 cut(s)	34, 118
MseI	TTAA	2 cut(s)	60, 187
SaqAI	TTAA	2 cut(s)	60, 187
SetI	ASST	3 cut(s)	45, 136, 149
SfaNI	GCATC	1 cut(s)	22
SgeI	CNNG	3 cut(s)	18, 50, 151
SmlI	CTYRAG	1 cut(s)	38
SmoI	CTYRAG	1 cut(s)	38
Sse9I	AATT	1 cut(s)	128
TaaI	ACNGT	2 cut(s)	158, 171
TaiI	ACGT	1 cut(s)	136
TasI	AATT	1 cut(s)	128
Tru1I	TTAA	2 cut(s)	60, 187
Tru9I	TTAA	2 cut(s)	60, 187
TspDTI	ATGAA	1 cut(s)	66

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.