Rroxscaffold_1G00048310

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
68297699 .. 68298887
1189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00048310.1

Sequence Viewer

Length: 465 bp
ATGGTTGAGGAAAGTGAAAGTGGTGCTTTGAATGACTTGGTCTATAACAAAAATGTTGATGCATTCATACCAACAAGGGATGAATCATCATTCCAAGGTTATTCACCACCGCCATCATCCTTACCTTTTGAGGGCACGAATGTGGGAGTTGCTAATAACAATGTGGAAAAGAATACTGGAAGTAGTGCAACTGGAAAACGCAACGGGAATGATTTTGAGAGAAATAATAGCTTGACCGATGATATTTCGAAGCCGATGTTAGGAAAAGCATTGATACTTCTAGGTATTTGCATAATGGCAGATACAAATGAAGATATGGATGTCATGAATGAAGATGATATGGATGATGAAGAATTTTTTGAAGCTATAAAGGGTATCTTGATGGCAATACAAGCAATTATCCATCCGGTACATGAGTTTATGTCCATCCAAAATCATAGACGTATTGAACGTCCACTAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

154

Amino Acids

17.07

Weight (kDa)

4.36

Isoelectric Point (pI)

41.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020127)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 110
AcsI RAATTY 1 cut(s) 353
AfaI GTAC 1 cut(s) 411
AfiI CCNNNNNNNGG 2 cut(s) 131, 260
AgsI TTSAA 3 cut(s) 31, 362, 449
AleI CACNNNNGTG 1 cut(s) 140
AluBI AGCT 2 cut(s) 231, 365
AluI AGCT 2 cut(s) 231, 365
ApoI RAATTY 1 cut(s) 353
AsuHPI GGTGA 1 cut(s) 96
AsuII TTCGAA 1 cut(s) 248
BaeGI GKGCMC 1 cut(s) 137
BaeI ACNNNNGTAYC 2 cut(s) 401, 434
BccI CCATC 4 cut(s) 121, 376, 411, 434
BfaI CTAG 1 cut(s) 281
BmsI GCATC 1 cut(s) 49
Bpu14I TTCGAA 1 cut(s) 248
BsaJI CCNNGG 1 cut(s) 94
BsaWI WCCGGW 1 cut(s) 406
Bsc4I CCNNNNNNNGG 2 cut(s) 131, 260
Bse1I ACTGG 2 cut(s) 181, 196
BseDI CCNNGG 1 cut(s) 94
BseGI GGATG 6 cut(s) 85, 116, 325, 349, 403, 426
BseLI CCNNNNNNNGG 2 cut(s) 131, 260
BseNI ACTGG 2 cut(s) 181, 196
BseSI GKGCMC 1 cut(s) 137
BsiSI CCGG 1 cut(s) 407
BslI CCNNNNNNNGG 2 cut(s) 131, 260
BsmI GAATGC 1 cut(s) 62
Bsp119I TTCGAA 1 cut(s) 248
Bsp1286I GDGCHC 1 cut(s) 137
BspACI CCGC 1 cut(s) 110
BspHI TCATGA 1 cut(s) 324
BspT104I TTCGAA 1 cut(s) 248
BsrI ACTGG 2 cut(s) 181, 196
BssECI CCNNGG 1 cut(s) 94
BssT1I CCWWGG 1 cut(s) 94
BstBI TTCGAA 1 cut(s) 248
BstF5I GGATG 6 cut(s) 85, 116, 325, 349, 403, 426
BstMWI GCNNNNNNNGC 1 cut(s) 392
BstSLI GKGCMC 1 cut(s) 137
BtsCI GGATG 6 cut(s) 85, 116, 325, 349, 403, 426
CciI TCATGA 1 cut(s) 324
Csp6I GTAC 1 cut(s) 410
CviAII CATG 2 cut(s) 325, 413
CviJI RGCY 3 cut(s) 231, 253, 365
CviKI_1 RGCY 3 cut(s) 231, 253, 365
CviQI GTAC 1 cut(s) 410
Eco130I CCWWGG 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 94
EcoT22I ATGCAT 1 cut(s) 64
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 2 cut(s) 328, 416
FalI AAGNNNNNCTT 4 cut(s) 10, 42, 362, 394
FatI CATG 2 cut(s) 324, 412
FokI GGATG 6 cut(s) 92, 103, 332, 356, 390, 413
FspBI CTAG 1 cut(s) 281
HapII CCGG 1 cut(s) 407
Hin1II CATG 2 cut(s) 328, 416
HinfI GANTC 1 cut(s) 83
HpaII CCGG 1 cut(s) 407
HphI GGTGA 1 cut(s) 96
Hpy166II GTNNAC 1 cut(s) 455
Hpy188III TCNNGA 2 cut(s) 325, 379
Hpy8I GTNNAC 1 cut(s) 455
HpyCH4IV ACGT 2 cut(s) 442, 451
HpyCH4V TGCA 3 cut(s) 62, 188, 291
HpyF10VI GCNNNNNNNGC 1 cut(s) 392
HpySE526I ACGT 2 cut(s) 442, 451
Hsp92II CATG 2 cut(s) 328, 416
LpnPI CCDG 3 cut(s) 162, 177, 420
LweI GCATC 1 cut(s) 49
MaeI CTAG 1 cut(s) 281
MaeII ACGT 2 cut(s) 442, 451
MboII GAAGA 3 cut(s) 323, 344, 362
MhlI GDGCHC 1 cut(s) 137
MluCI AATT 2 cut(s) 353, 396
MnlI CCTC 1 cut(s) 124
Mph1103I ATGCAT 1 cut(s) 64
MslI CAYNNNNRTG 1 cut(s) 140
MspI CCGG 1 cut(s) 407
Mva1269I GAATGC 1 cut(s) 62
MwoI GCNNNNNNNGC 1 cut(s) 392
NlaIII CATG 2 cut(s) 328, 416
NsiI ATGCAT 1 cut(s) 64
NspV TTCGAA 1 cut(s) 248
OliI CACNNNNGTG 1 cut(s) 140
PagI TCATGA 1 cut(s) 324
PcsI WCGNNNNNNNCGW 1 cut(s) 448
PctI GAATGC 1 cut(s) 62
PfeI GAWTC 1 cut(s) 83
PflFI GACNNNGTC 1 cut(s) 38
PsyI GACNNNGTC 1 cut(s) 38
RsaI GTAC 1 cut(s) 411
RsaNI GTAC 1 cut(s) 410
RseI CAYNNNNRTG 1 cut(s) 140
SduI GDGCHC 1 cut(s) 137
SetI ASST 7 cut(s) 100, 127, 233, 286, 367, 445, 454
SfaNI GCATC 1 cut(s) 49
SfuI TTCGAA 1 cut(s) 248
SmiMI CAYNNNNRTG 1 cut(s) 140
Sse9I AATT 2 cut(s) 353, 396
SsiI CCGC 1 cut(s) 110
SspMI CTAG 1 cut(s) 281
StyI CCWWGG 1 cut(s) 94
TaiI ACGT 2 cut(s) 445, 454
TaqI TCGA 1 cut(s) 248
TaqII GACCGA 1 cut(s) 251
TasI AATT 2 cut(s) 353, 396
TfiI GAWTC 1 cut(s) 83
TspDTI ATGAA 6 cut(s) 55, 96, 324, 341, 345, 363
Tth111I GACNNNGTC 1 cut(s) 38
XapI RAATTY 1 cut(s) 353
XspI CTAG 1 cut(s) 281
Zsp2I ATGCAT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.