Rroxscaffold_1G00074030

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
94954511 .. 94958900
4390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00074030.1

Sequence Viewer

Length: 372 bp
ATGAGTCATCACACCAAGAAAACTCGCCATCTCTTTCACAACAACCCTCCCAAGGTACCAAGTATAGATGCTCCAGCTCCACCACATAGCAGGACTCAAGGAAAACGGAGTAGAACCGACTATGAAAATAATAGTGGCTCAAAAGGGGCTACGGTCAGCCGAGGTTCTAGAAAACTTATCAAGTGGCATTGCTACTTGATATTGAGTAATGAAATATCTATAGTTGTTGTCCCATCTTATTTAAATGCAGGCTTCAATTTCGCCAAATCAGTCATGTTTGCATTTGGCATGATGCCATCATCCACAGAAATTGTAACATGCCTCACCTCTCCAATTTCACATTTGTATCACTATATCCAGATGACAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

13.8

Weight (kDa)

9.95

Isoelectric Point (pI)

56.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020127)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 55
AccB1I GGYRCC 1 cut(s) 55
AfaI GTAC 1 cut(s) 57
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 256
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
Asp718I GGTACC 1 cut(s) 55
AsuHPI GGTGA 1 cut(s) 316
BaeI ACNNNNGTAYC 2 cut(s) 329, 362
BanI GGYRCC 1 cut(s) 55
BccI CCATC 3 cut(s) 36, 241, 304
BfaI CTAG 1 cut(s) 168
BfmI CTRYAG 1 cut(s) 219
BmiI GGNNCC 1 cut(s) 57
BmsI GCATC 2 cut(s) 58, 282
BpmI CTGGAG 1 cut(s) 57
BpuEI CTTGAG 1 cut(s) 81
BsaJI CCNNGG 2 cut(s) 51, 160
Bsc4I CCNNNNNNNGG 1 cut(s) 52
Bse3DI GCAATG 1 cut(s) 187
BseDI CCNNGG 2 cut(s) 51, 160
BseGI GGATG 1 cut(s) 299
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMI GCAATG 1 cut(s) 187
BshNI GGYRCC 1 cut(s) 55
BslFI GGGAC 1 cut(s) 215
BslI CCNNNNNNNGG 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 215
BspLI GGNNCC 1 cut(s) 57
BspT107I GGYRCC 1 cut(s) 55
BsrDI GCAATG 1 cut(s) 187
BssECI CCNNGG 2 cut(s) 51, 160
BssT1I CCWWGG 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 154
BstC8I GCNNGC 1 cut(s) 250
BstF5I GGATG 1 cut(s) 299
BstNSI RCATGY 1 cut(s) 321
BstSFI CTRYAG 1 cut(s) 219
BtsCI GGATG 1 cut(s) 299
Cac8I GCNNGC 1 cut(s) 250
Csp6I GTAC 1 cut(s) 56
CspCI CAANNNNNGTGG 2 cut(s) 292, 327
CviAII CATG 3 cut(s) 274, 289, 318
CviJI RGCY 5 cut(s) 77, 138, 149, 159, 252
CviKI_1 RGCY 5 cut(s) 77, 138, 149, 159, 252
CviQI GTAC 1 cut(s) 56
DraI TTTAAA 1 cut(s) 243
Eco130I CCWWGG 1 cut(s) 51
EcoT14I CCWWGG 1 cut(s) 51
ErhI CCWWGG 1 cut(s) 51
FaeI CATG 3 cut(s) 277, 292, 321
FaiI YATR 8 cut(s) 65, 87, 123, 221, 275, 290, 319, 354
FaqI GGGAC 1 cut(s) 215
FatI CATG 3 cut(s) 273, 288, 317
FokI GGATG 1 cut(s) 286
FspBI CTAG 1 cut(s) 168
GsuI CTGGAG 1 cut(s) 57
Hin1II CATG 3 cut(s) 277, 292, 321
HinfI GANTC 2 cut(s) 4, 94
HphI GGTGA 1 cut(s) 316
Hpy188III TCNNGA 2 cut(s) 168, 358
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 248, 281
Hsp92II CATG 3 cut(s) 277, 292, 321
KpnI GGTACC 1 cut(s) 59
LmnI GCTCC 2 cut(s) 76, 82
LpnPI CCDG 3 cut(s) 76, 87, 234
LweI GCATC 2 cut(s) 58, 282
MaeI CTAG 1 cut(s) 168
MaeIII GTNAC 1 cut(s) 313
MluCI AATT 4 cut(s) 256, 309, 333, 367
MlyI GAGTC 2 cut(s) 13, 88
MnlI CCTC 4 cut(s) 57, 155, 332, 337
MseI TTAA 2 cut(s) 242, 370
NlaIII CATG 3 cut(s) 277, 292, 321
NlaIV GGNNCC 1 cut(s) 57
NmeAIII GCCGAG 1 cut(s) 185
NspI RCATGY 1 cut(s) 321
PleI GAGTC 2 cut(s) 12, 88
PpsI GAGTC 2 cut(s) 12, 88
PspN4I GGNNCC 1 cut(s) 57
RsaI GTAC 1 cut(s) 57
RsaNI GTAC 1 cut(s) 56
SaqAI TTAA 2 cut(s) 242, 370
SchI GAGTC 2 cut(s) 13, 88
SetI ASST 4 cut(s) 57, 79, 166, 329
SfaNI GCATC 2 cut(s) 58, 282
SfcI CTRYAG 1 cut(s) 219
SmiI ATTTAAAT 1 cut(s) 243
SmlI CTYRAG 1 cut(s) 96
SmoI CTYRAG 1 cut(s) 96
Sse9I AATT 4 cut(s) 256, 309, 333, 367
SspMI CTAG 1 cut(s) 168
StyI CCWWGG 1 cut(s) 51
SwaI ATTTAAAT 1 cut(s) 243
TaaI ACNGT 1 cut(s) 154
TasI AATT 4 cut(s) 256, 309, 333, 367
Tru1I TTAA 2 cut(s) 242, 370
Tru9I TTAA 2 cut(s) 242, 370
TspDTI ATGAA 2 cut(s) 138, 225
TspGWI ACGGA 1 cut(s) 121
XbaI TCTAGA 1 cut(s) 167
XceI RCATGY 1 cut(s) 321
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.