Rroxscaffold_2G00109930

Belongs to the universal ribosomal protein uS11 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
34187709 .. 34189483
1775 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00109930.1

Sequence Viewer

Length: 213 bp
ATGCTCATATTTATGCACTGCATGCTTGCAGCACAGGATGTATCTACGCAGTGCTTGGTTCTTGGAATTAGTCCTTTGCATATAAAGCTCAAGGCTGCTGGTCCATTTGCTCAGTCAGCAATGAGAGCACTTTCTCGTGCTGACATGACCAATTTCCACCAACAATACCCACAGAAAGCTTGTCTGGAAGAAGGTGACTTAATAAAAGGTTGA

Protein Analysis

70

Amino Acids

7.69

Weight (kDa)

7.77

Isoelectric Point (pI)

55.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S11 PF00411 7 - 49 1.9e-07 Ribosomal protein S11
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018977)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 88, 179
AluI AGCT 2 cut(s) 88, 179
Alw21I GWGCWC 1 cut(s) 130
ApeKI GCWGC 2 cut(s) 29, 95
AspS9I GGNCC 1 cut(s) 101
AsuHPI GGTGA 1 cut(s) 206
AvaII GGWCC 1 cut(s) 101
BauI CACGAG 1 cut(s) 135
Bbv12I GWGCWC 1 cut(s) 130
BbvI GCAGC 2 cut(s) 41, 82
BisI GCNGC 2 cut(s) 30, 96
BlsI GCNGC 2 cut(s) 31, 97
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
BpuEI CTTGAG 1 cut(s) 74
Bse3DI GCAATG 1 cut(s) 126
BseGI GGATG 1 cut(s) 43
BseMI GCAATG 1 cut(s) 126
BseMII CTCAG 1 cut(s) 125
BseXI GCAGC 2 cut(s) 41, 82
BsiHKAI GWGCWC 1 cut(s) 130
Bsp1286I GDGCHC 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 124
BsrDI GCAATG 1 cut(s) 126
BssSI CACGAG 1 cut(s) 135
Bst2BI CACGAG 1 cut(s) 135
BstAPI GCANNNNNTGC 1 cut(s) 22
BstC8I GCNNGC 2 cut(s) 23, 27
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 43
BstMWI GCNNNNNNNGC 4 cut(s) 22, 85, 116, 125
BstNSI RCATGY 1 cut(s) 25
BstV1I GCAGC 2 cut(s) 41, 82
BtsCI GGATG 1 cut(s) 43
BtsI GCAGTG 2 cut(s) 16, 56
BtsIMutI CAGTG 2 cut(s) 16, 56
Cac8I GCNNGC 2 cut(s) 23, 27
Cfr13I GGNCC 1 cut(s) 101
CviAII CATG 2 cut(s) 22, 145
CviJI RGCY 3 cut(s) 88, 95, 179
CviKI_1 RGCY 3 cut(s) 88, 95, 179
DdeI CTNAG 1 cut(s) 111
Eco47I GGWCC 1 cut(s) 101
FaeI CATG 2 cut(s) 25, 148
FaiI YATR 6 cut(s) 8, 14, 23, 81, 83, 146
FatI CATG 2 cut(s) 21, 144
Fnu4HI GCNGC 2 cut(s) 30, 96
FokI GGATG 1 cut(s) 50
Fsp4HI GCNGC 2 cut(s) 30, 96
GluI GCNGC 2 cut(s) 30, 96
Hin1II CATG 2 cut(s) 25, 148
HindIII AAGCTT 1 cut(s) 177
HphI GGTGA 1 cut(s) 206
Hpy188III TCNNGA 1 cut(s) 185
HpyAV CCTTC 1 cut(s) 185
HpyCH4V TGCA 4 cut(s) 16, 21, 29, 79
HpyF10VI GCNNNNNNNGC 4 cut(s) 22, 85, 116, 125
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 2 cut(s) 25, 148
LpnPI CCDG 3 cut(s) 20, 84, 170
Lsp1109I GCAGC 2 cut(s) 41, 82
MaeIII GTNAC 1 cut(s) 194
MboII GAAGA 1 cut(s) 200
MhlI GDGCHC 1 cut(s) 130
MluCI AATT 2 cut(s) 66, 151
MseI TTAA 1 cut(s) 200
MslI CAYNNNNRTG 1 cut(s) 11
MwoI GCNNNNNNNGC 4 cut(s) 22, 85, 116, 125
NlaIII CATG 2 cut(s) 25, 148
NmuCI GTSAC 1 cut(s) 194
NspI RCATGY 1 cut(s) 25
PaeI GCATGC 1 cut(s) 25
PkrI GCNGC 2 cut(s) 31, 97
PspPI GGNCC 1 cut(s) 101
RseI CAYNNNNRTG 1 cut(s) 11
SaqAI TTAA 1 cut(s) 200
SatI GCNGC 2 cut(s) 30, 96
Sau96I GGNCC 1 cut(s) 101
SduI GDGCHC 1 cut(s) 130
SetI ASST 4 cut(s) 90, 181, 196, 211
SinI GGWCC 1 cut(s) 101
SmiMI CAYNNNNRTG 1 cut(s) 11
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
SphI GCATGC 1 cut(s) 25
Sse9I AATT 2 cut(s) 66, 151
TasI AATT 2 cut(s) 66, 151
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TscAI CASTG 2 cut(s) 23, 56
TseFI GTSAC 1 cut(s) 194
TseI GCWGC 2 cut(s) 29, 95
Tsp45I GTSAC 1 cut(s) 194
TspRI CASTG 2 cut(s) 23, 56
VpaK11BI GGWCC 1 cut(s) 101
XceI RCATGY 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.