Rroxscaffold_2G00115190
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
41418583 .. 41420921
2339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00115190.1

Sequence Viewer

Length: 153 bp
ATGAAAGCAGATAGGGTTAAAAGCAACATCGTGTTGGAGCACCCCAATATAGTGAGCCTCAAGGGTGTTGAATACCAAAACGACGACGTCTTCTTTGTTTTTGAGTACATGGAGGGGAGCCTTGGTGATCTTATTGATGAGAGCAAGGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.74

Weight (kDa)

4.41

Isoelectric Point (pI)

27.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021319)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0332681
rosa_roxburghii Rroxscaffold_2G00115190
rosa_samantha Rh2AG279300 Rh2DG285200 Rh2DG304300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 90
AcyI GRCGYC 1 cut(s) 87
AfaI GTAC 1 cut(s) 107
AgsI TTSAA 1 cut(s) 71
Alw21I GWGCWC 1 cut(s) 42
ArsI GACNNNNNNTTYG 2 cut(s) 77, 109
AsuHPI GGTGA 1 cut(s) 137
BbsI GAAGAC 1 cut(s) 82
Bbv12I GWGCWC 1 cut(s) 42
BmiI GGNNCC 1 cut(s) 119
BpiI GAAGAC 1 cut(s) 82
BpuEI CTTGAG 1 cut(s) 44
BsaHI GRCGYC 1 cut(s) 87
BsaJI CCNNGG 1 cut(s) 121
BsaXI ACNNNNNCTCC 2 cut(s) 109, 139
BseDI CCNNGG 1 cut(s) 121
BsiHKAI GWGCWC 1 cut(s) 42
Bsp1286I GDGCHC 1 cut(s) 42
Bsp143I GATC 1 cut(s) 127
BspLI GGNNCC 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 121
BssMI GATC 1 cut(s) 127
BssNI GRCGYC 1 cut(s) 87
BssT1I CCWWGG 1 cut(s) 121
BstACI GRCGYC 1 cut(s) 87
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstV2I GAAGAC 1 cut(s) 82
Csp6I GTAC 1 cut(s) 106
CviAII CATG 1 cut(s) 109
CviJI RGCY 2 cut(s) 57, 120
CviKI_1 RGCY 2 cut(s) 57, 120
CviQI GTAC 1 cut(s) 106
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
Eco130I CCWWGG 1 cut(s) 121
EcoT14I CCWWGG 1 cut(s) 121
ErhI CCWWGG 1 cut(s) 121
FaeI CATG 1 cut(s) 112
FaiI YATR 2 cut(s) 50, 110
FatI CATG 1 cut(s) 108
Hin1I GRCGYC 1 cut(s) 87
Hin1II CATG 1 cut(s) 112
HphI GGTGA 1 cut(s) 137
Hpy99I CGWCG 2 cut(s) 86, 89
HpyCH4IV ACGT 1 cut(s) 87
HpySE526I ACGT 1 cut(s) 87
Hsp92I GRCGYC 1 cut(s) 87
Hsp92II CATG 1 cut(s) 112
Kzo9I GATC 1 cut(s) 127
LmnI GCTCC 2 cut(s) 37, 117
MaeII ACGT 1 cut(s) 87
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 1 cut(s) 82
MhlI GDGCHC 1 cut(s) 42
MmeI TCCRAC 1 cut(s) 15
MnlI CCTC 2 cut(s) 68, 106
MseI TTAA 1 cut(s) 18
NdeII GATC 1 cut(s) 127
NlaIII CATG 1 cut(s) 112
NlaIV GGNNCC 1 cut(s) 119
PflFI GACNNNGTC 1 cut(s) 86
PspN4I GGNNCC 1 cut(s) 119
PsyI GACNNNGTC 1 cut(s) 86
RsaI GTAC 1 cut(s) 107
RsaNI GTAC 1 cut(s) 106
SaqAI TTAA 1 cut(s) 18
Sau3AI GATC 1 cut(s) 127
SduI GDGCHC 1 cut(s) 42
SetI ASST 1 cut(s) 90
SgeI CNNG 4 cut(s) 43, 73, 121, 134
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
StyI CCWWGG 1 cut(s) 121
TaiI ACGT 1 cut(s) 90
TatI WGTACW 1 cut(s) 105
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TspDTI ATGAA 1 cut(s) 17
Tth111I GACNNNGTC 1 cut(s) 86
ZraI GACGTC 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.