Rroxscaffold_2G00133340

protein dimerization activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0019844
Physical Location & Seq
Forward (+)
70487450 .. 70489990
2541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00133340.1

Sequence Viewer

Length: 285 bp
ATGCAAGACAAGTTTCTCAAGTATTGGGGTAGCTTTGATAAGTTGAATCACTATCTATTCATTGCTATTGTTCTTGATCCACGTCATAAACTTGAGAAAGTTGTTGACTATTTTGAGATTCTTGATGATGGGAATATGGATGAAAATGTGGAAGCTAACACGAAGACTGTGAAAGATCTCTTGTATGACCTTTACAAGGTGTATGAGAAAGAGGGAAGGGAAAGTGGTGTTGGTGAGGTTGTTGGTTCTCAAGTATCAAGTGAGGGGATATCTAGTTCAATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4413 Dimer_Tnp_hAT

Protein Analysis

94

Amino Acids

10.8

Weight (kDa)

4.68

Isoelectric Point (pI)

20.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
hAT-like_RNase-H PF14372 1 - 68 1.1e-10 hAT-like transposase, RNase-H fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019844)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0337501 RchiOBHm_Chr4g0404941 RchiOBHm_Chr5g0057011
rosa_multiflora Rmu_sc0006088.1_g000013
rosa_roxburghii Rroxscaffold_2G00133340
rosa_samantha Rh4AG092300 Rh4CG100800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 71
AfiI CCNNNNNNNGG 1 cut(s) 196
AgsI TTSAA 2 cut(s) 46, 279
AjiI CACGTC 1 cut(s) 83
AjuI GAANNNNNNNTTGG 2 cut(s) 213, 245
AloI GAACNNNNNNTCC 1 cut(s) 259
AluBI AGCT 2 cut(s) 33, 155
AluI AGCT 2 cut(s) 33, 155
AlwI GGATC 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 245
BbsI GAAGAC 1 cut(s) 170
BccI CCATC 1 cut(s) 122
BfaI CTAG 1 cut(s) 273
BglII AGATCT 1 cut(s) 175
BmgBI CACGTC 1 cut(s) 83
BpiI GAAGAC 1 cut(s) 170
BpuEI CTTGAG 2 cut(s) 113, 234
Bsc4I CCNNNNNNNGG 1 cut(s) 196
Bse3DI GCAATG 1 cut(s) 60
BseGI GGATG 1 cut(s) 145
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMI GCAATG 1 cut(s) 60
BslI CCNNNNNNNGG 1 cut(s) 196
Bsp143I GATC 2 cut(s) 76, 175
BspPI GGATC 1 cut(s) 71
BsrDI GCAATG 1 cut(s) 60
BssMI GATC 2 cut(s) 76, 175
Bst4CI ACNGT 1 cut(s) 169
BstENI CCTNNNNNAGG 1 cut(s) 194
BstF5I GGATG 1 cut(s) 145
BstKTI GATC 2 cut(s) 79, 178
BstMBI GATC 2 cut(s) 76, 175
BstV2I GAAGAC 1 cut(s) 170
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
BtrI CACGTC 1 cut(s) 83
BtsCI GGATG 1 cut(s) 145
CviJI RGCY 2 cut(s) 33, 155
CviKI_1 RGCY 2 cut(s) 33, 155
DpnI GATC 2 cut(s) 78, 177
DpnII GATC 2 cut(s) 76, 175
Eco32I GATATC 1 cut(s) 270
EcoNI CCTNNNNNAGG 1 cut(s) 194
EcoRV GATATC 1 cut(s) 270
FaiI YATR 4 cut(s) 87, 137, 186, 204
FokI GGATG 1 cut(s) 152
FspBI CTAG 1 cut(s) 273
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HinfI GANTC 2 cut(s) 46, 118
HphI GGTGA 1 cut(s) 245
Hpy166II GTNNAC 1 cut(s) 106
Hpy188III TCNNGA 2 cut(s) 74, 122
Hpy8I GTNNAC 1 cut(s) 106
HpyAV CCTTC 1 cut(s) 210
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4IV ACGT 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 4
HpySE526I ACGT 1 cut(s) 82
Kzo9I GATC 2 cut(s) 76, 175
MaeI CTAG 1 cut(s) 273
MaeII ACGT 1 cut(s) 82
MalI GATC 2 cut(s) 78, 177
MboI GATC 2 cut(s) 76, 175
MboII GAAGA 1 cut(s) 175
MflI RGATCY 1 cut(s) 175
MluCI AATT 1 cut(s) 279
MnlI CCTC 3 cut(s) 205, 229, 256
NdeII GATC 2 cut(s) 76, 175
PfeI GAWTC 2 cut(s) 46, 118
PsuI RGATCY 1 cut(s) 175
Sau3AI GATC 2 cut(s) 76, 175
SetI ASST 6 cut(s) 35, 85, 157, 192, 201, 240
SmlI CTYRAG 3 cut(s) 17, 92, 249
SmoI CTYRAG 3 cut(s) 17, 92, 249
Sse9I AATT 1 cut(s) 279
SspMI CTAG 1 cut(s) 273
TaaI ACNGT 1 cut(s) 169
TaiI ACGT 1 cut(s) 85
TasI AATT 1 cut(s) 279
TfiI GAWTC 2 cut(s) 46, 118
TspDTI ATGAA 2 cut(s) 49, 156
XagI CCTNNNNNAGG 1 cut(s) 194
XspI CTAG 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.