Rroxscaffold_3G00238350

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
26491505 .. 26492708
1204 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00238350.1

Sequence Viewer

Length: 312 bp
ATGCTTAATTGTTTTCCACCTACACCACAACCTACCATGCCTTATACCACCACCAAAACCACCTCACATAACCAAATTCCACCTACTTATGCTACCACCACCACTCATATCCCACCATCCTTTCACATGATGCCACCCTACTATCCTCAATTTTCACAACAAGTGCCTCTATACTTATATTCACCATATGTCGATCCAAGCCTCCCCACTATGAAGCAAATGAAGTTAGATTTCAGCGTGTTTAGTGGTGGAGATCCAGTTGAGTGGCTCAACAAGGCTGAGCAAGATTTCGAATTCTATCAAATACCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.91

Weight (kDa)

5.33

Isoelectric Point (pI)

66.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020125)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g19792 FvH4_4g07791
pyrus_communis pycom13g26120 pycom16g15860
rosa_laevigata RLG00000022349
rosa_roxburghii Rroxscaffold_3G00238350

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 188, 248
AcsI RAATTY 2 cut(s) 75, 293
AlwI GGATC 2 cut(s) 188, 248
ApoI RAATTY 2 cut(s) 75, 293
AsuHPI GGTGA 1 cut(s) 174
AsuII TTCGAA 1 cut(s) 291
BccI CCATC 1 cut(s) 124
BlpI GCTNAGC 1 cut(s) 279
BmsI GCATC 1 cut(s) 120
Bpu1102I GCTNAGC 1 cut(s) 279
Bpu14I TTCGAA 1 cut(s) 291
BsaXI ACNNNNNCTCC 2 cut(s) 243, 273
Bse1I ACTGG 1 cut(s) 257
BseGI GGATG 1 cut(s) 116
BseMII CTCAG 1 cut(s) 270
BseNI ACTGG 1 cut(s) 257
Bsp119I TTCGAA 1 cut(s) 291
Bsp143I GATC 2 cut(s) 193, 253
Bsp1720I GCTNAGC 1 cut(s) 279
BspCNI CTCAG 1 cut(s) 271
BspPI GGATC 2 cut(s) 188, 248
BspT104I TTCGAA 1 cut(s) 291
BsrI ACTGG 1 cut(s) 257
BssMI GATC 2 cut(s) 193, 253
BstBI TTCGAA 1 cut(s) 291
BstDEI CTNAG 2 cut(s) 279, 309
BstF5I GGATG 1 cut(s) 116
BstKTI GATC 2 cut(s) 196, 256
BstMBI GATC 2 cut(s) 193, 253
BstX2I RGATCY 1 cut(s) 253
BstXI CCANNNNNNTGG 1 cut(s) 264
BstYI RGATCY 1 cut(s) 253
BtsCI GGATG 1 cut(s) 116
CviAII CATG 2 cut(s) 37, 127
CviJI RGCY 3 cut(s) 201, 268, 278
CviKI_1 RGCY 3 cut(s) 201, 268, 278
DdeI CTNAG 2 cut(s) 279, 309
DpnI GATC 2 cut(s) 195, 255
DpnII GATC 2 cut(s) 193, 253
EcoRI GAATTC 1 cut(s) 293
FaeI CATG 2 cut(s) 40, 130
FatI CATG 2 cut(s) 36, 126
FauNDI CATATG 1 cut(s) 187
FokI GGATG 1 cut(s) 103
Hin1II CATG 2 cut(s) 40, 130
HphI GGTGA 1 cut(s) 174
HpyF3I CTNAG 2 cut(s) 279, 309
Hsp92II CATG 2 cut(s) 40, 130
Kzo9I GATC 2 cut(s) 193, 253
LpnPI CCDG 1 cut(s) 270
LweI GCATC 1 cut(s) 120
MalI GATC 2 cut(s) 195, 255
MboI GATC 2 cut(s) 193, 253
MflI RGATCY 1 cut(s) 253
MluCI AATT 4 cut(s) 7, 75, 149, 293
MnlI CCTC 4 cut(s) 73, 156, 177, 212
MseI TTAA 1 cut(s) 6
NdeI CATATG 1 cut(s) 187
NdeII GATC 2 cut(s) 193, 253
NlaIII CATG 2 cut(s) 40, 130
NspV TTCGAA 1 cut(s) 291
PsuI RGATCY 1 cut(s) 253
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 2 cut(s) 193, 253
SetI ASST 5 cut(s) 22, 34, 65, 85, 310
SfaNI GCATC 1 cut(s) 120
SfuI TTCGAA 1 cut(s) 291
SgeI CNNG 8 cut(s) 49, 139, 173, 210, 250, 269, 286, 296
Sse9I AATT 4 cut(s) 7, 75, 149, 293
TaqI TCGA 2 cut(s) 192, 291
TasI AATT 4 cut(s) 7, 75, 149, 293
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TspDTI ATGAA 2 cut(s) 227, 236
XapI RAATTY 2 cut(s) 75, 293
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.