Rroxscaffold_5G00355450

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
34103928 .. 34104347
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00355450.1

Sequence Viewer

Length: 156 bp
ATGAAACATATAACCAAAACACTCACAATACAAATCCTACTATTGCTTGATCATCTCATTAAGAAAAAGGCTATTAGCAGATTCTTCTGCAGGTCAAACCCATTGTGTTTATCTCTGGCATTTATTGGGCAAGTTGGTCTCAAGAGGTGGCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.92

Weight (kDa)

10.66

Isoelectric Point (pI)

51.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019981)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 81
Alw26I GTCTC 1 cut(s) 143
BclI TGATCA 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 143
BfmI CTRYAG 1 cut(s) 88
BfuAI ACCTGC 1 cut(s) 81
BpuEI CTTGAG 1 cut(s) 125
BsaI GGTCTC 1 cut(s) 143
BsmAI GTCTC 1 cut(s) 143
Bso31I GGTCTC 1 cut(s) 143
Bsp143I GATC 1 cut(s) 49
BspMAI CTGCAG 1 cut(s) 92
BspMI ACCTGC 1 cut(s) 81
BspTNI GGTCTC 1 cut(s) 143
BssMI GATC 1 cut(s) 49
BstKTI GATC 1 cut(s) 52
BstMAI GTCTC 1 cut(s) 143
BstMBI GATC 1 cut(s) 49
BstSFI CTRYAG 1 cut(s) 88
BveI ACCTGC 1 cut(s) 81
CviJI RGCY 2 cut(s) 71, 151
CviKI_1 RGCY 2 cut(s) 71, 151
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
Eco31I GGTCTC 1 cut(s) 143
FaiI YATR 2 cut(s) 9, 11
FbaI TGATCA 1 cut(s) 49
HinfI GANTC 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 155
Hpy188III TCNNGA 1 cut(s) 142
HpyCH4V TGCA 1 cut(s) 90
Ksp22I TGATCA 1 cut(s) 49
Kzo9I GATC 1 cut(s) 49
LpnPI CCDG 2 cut(s) 76, 101
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MboII GAAGA 1 cut(s) 76
MnlI CCTC 1 cut(s) 138
MseI TTAA 1 cut(s) 60
NdeII GATC 1 cut(s) 49
PfeI GAWTC 1 cut(s) 81
PstI CTGCAG 1 cut(s) 92
SaqAI TTAA 1 cut(s) 60
Sau3AI GATC 1 cut(s) 49
SetI ASST 2 cut(s) 95, 149
SfcI CTRYAG 1 cut(s) 88
SgeI CNNG 4 cut(s) 59, 103, 128, 143
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
TfiI GAWTC 1 cut(s) 81
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.