Rroxscaffold_5G00361660

Gibberellin 3-beta-dioxygenase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
42363880 .. 42371008
7129 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00361660.1

Sequence Viewer

Length: 315 bp
ATGCTAGCGTTTTATAGTAAACATCATAAGATACCTCCGCAGTTGAGAGCCGAAACCTTCACTGTGTCAAGGCAACTTTTCACCCTTCCACTTGAGACAAAGAAGAAGAACCTTATCCAAAACCTTACCAGGATTACATTGGACCAAATGCCAAGGTCCCTCTGTATGAGAGTTTTGGCCTTGAGGAAGCCTCCAACTATAGATGAATCCCTTAAAAACTTGATAGAAGAAATGTGGCCTAACGGTCATGACCAGTTTTGCACTGTAATTTCTATGCTGAAGCAACTGGAGCAACTGGAGGATATGATTAACTAG

Protein Analysis

104

Amino Acids

12.25

Weight (kDa)

9.06

Isoelectric Point (pI)

54.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DIOX_N PF14226 4 - 37 8.1e-06 non-haem dioxygenase in morphine synthesis N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019920)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0418431
rosa_multiflora Rmu_co8108702.1_g000001 Rmu_sc0001266.1_g000007
rosa_roxburghii Rroxscaffold_5G00361660
rosa_rugosa Rorug04G0153000
rosa_samantha Rh4BG216000 Rh5CG319300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 38
AcuI CTGAAG 1 cut(s) 299
AjnI CCWGG 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 89
AoxI GGCC 2 cut(s) 177, 236
AspS9I GGNCC 2 cut(s) 142, 156
AsuHPI GGTGA 1 cut(s) 73
AsuNHI GCTAGC 1 cut(s) 4
AvaII GGWCC 2 cut(s) 142, 156
BciT130I CCWGG 1 cut(s) 130
BcoDI GTCTC 1 cut(s) 89
BfaI CTAG 2 cut(s) 5, 313
BfmI CTRYAG 1 cut(s) 198
Bme1390I CCNGG 1 cut(s) 130
Bme18I GGWCC 2 cut(s) 142, 156
BmgT120I GGNCC 2 cut(s) 142, 156
BmiI GGNNCC 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 130
BmtI GCTAGC 1 cut(s) 8
BplI GAGNNNNNCTC 2 cut(s) 175, 207
BpmI CTGGAG 1 cut(s) 308
BpuEI CTTGAG 2 cut(s) 113, 202
BsaJI CCNNGG 1 cut(s) 152
Bse1I ACTGG 3 cut(s) 253, 291, 300
BseBI CCWGG 1 cut(s) 130
BseDI CCNNGG 1 cut(s) 152
BseNI ACTGG 3 cut(s) 253, 291, 300
BshFI GGCC 2 cut(s) 179, 238
BslFI GGGAC 1 cut(s) 142
BsmAI GTCTC 1 cut(s) 89
BsmFI GGGAC 1 cut(s) 142
BsnI GGCC 2 cut(s) 179, 238
BspACI CCGC 1 cut(s) 38
BspANI GGCC 2 cut(s) 179, 238
BspHI TCATGA 1 cut(s) 247
BspLI GGNNCC 1 cut(s) 158
BspOI GCTAGC 1 cut(s) 8
BsrI ACTGG 3 cut(s) 253, 291, 300
BssECI CCNNGG 1 cut(s) 152
BssT1I CCWWGG 1 cut(s) 152
Bst2UI CCWGG 1 cut(s) 130
Bst4CI ACNGT 3 cut(s) 64, 245, 265
BstC8I GCNNGC 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 89
BstMWI GCNNNNNNNGC 1 cut(s) 289
BstNI CCWGG 1 cut(s) 130
BstSCI CCNGG 1 cut(s) 128
BstSFI CTRYAG 1 cut(s) 198
BsuRI GGCC 2 cut(s) 179, 238
BtsIMutI CAGTG 2 cut(s) 60, 261
Cac8I GCNNGC 1 cut(s) 6
CciI TCATGA 1 cut(s) 247
Cfr13I GGNCC 2 cut(s) 142, 156
CviAII CATG 1 cut(s) 248
CviJI RGCY 4 cut(s) 50, 179, 190, 238
CviKI_1 RGCY 4 cut(s) 50, 179, 190, 238
Eco130I CCWWGG 1 cut(s) 152
Eco47I GGWCC 2 cut(s) 142, 156
Eco57I CTGAAG 1 cut(s) 299
EcoO109I RGGNCCY 1 cut(s) 156
EcoRII CCWGG 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 152
ErhI CCWWGG 1 cut(s) 152
FaeI CATG 1 cut(s) 251
FaiI YATR 7 cut(s) 15, 27, 167, 200, 249, 275, 305
FaqI GGGAC 1 cut(s) 142
FatI CATG 1 cut(s) 247
FspBI CTAG 2 cut(s) 5, 313
GsuI CTGGAG 1 cut(s) 308
HaeIII GGCC 2 cut(s) 179, 238
Hin1II CATG 1 cut(s) 251
HinfI GANTC 1 cut(s) 206
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 20
Hpy188III TCNNGA 1 cut(s) 248
Hpy8I GTNNAC 1 cut(s) 20
HpyAV CCTTC 2 cut(s) 67, 95
HpyCH4III ACNGT 3 cut(s) 64, 245, 265
HpyCH4V TGCA 1 cut(s) 261
HpyF10VI GCNNNNNNNGC 1 cut(s) 289
Hsp92II CATG 1 cut(s) 251
LmnI GCTCC 1 cut(s) 289
LpnPI CCDG 5 cut(s) 115, 142, 266, 272, 281
MaeI CTAG 2 cut(s) 5, 313
MboII GAAGA 3 cut(s) 115, 118, 239
MluCI AATT 1 cut(s) 267
MmeI TCCRAC 1 cut(s) 218
MnlI CCTC 5 cut(s) 45, 170, 177, 201, 292
MseI TTAA 2 cut(s) 213, 309
MspR9I CCNGG 1 cut(s) 130
MvaI CCWGG 1 cut(s) 130
MwoI GCNNNNNNNGC 1 cut(s) 289
NheI GCTAGC 1 cut(s) 4
NlaIII CATG 1 cut(s) 251
NlaIV GGNNCC 1 cut(s) 158
PagI TCATGA 1 cut(s) 247
PfeI GAWTC 1 cut(s) 206
PpuMI RGGWCCY 1 cut(s) 156
Psp5II RGGWCCY 1 cut(s) 156
Psp6I CCWGG 1 cut(s) 128
PspGI CCWGG 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 158
PspPI GGNCC 2 cut(s) 142, 156
PspPPI RGGWCCY 1 cut(s) 156
SaqAI TTAA 2 cut(s) 213, 309
Sau96I GGNCC 2 cut(s) 142, 156
ScrFI CCNGG 1 cut(s) 130
SetI ASST 5 cut(s) 37, 59, 114, 126, 158
SfcI CTRYAG 1 cut(s) 198
SinI GGWCC 2 cut(s) 142, 156
SmlI CTYRAG 2 cut(s) 92, 181
SmoI CTYRAG 2 cut(s) 92, 181
Sse9I AATT 1 cut(s) 267
SsiI CCGC 1 cut(s) 38
SspMI CTAG 2 cut(s) 5, 313
StyD4I CCNGG 1 cut(s) 128
StyI CCWWGG 1 cut(s) 152
TaaI ACNGT 3 cut(s) 64, 245, 265
TasI AATT 1 cut(s) 267
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 2 cut(s) 213, 309
Tru9I TTAA 2 cut(s) 213, 309
TscAI CASTG 2 cut(s) 67, 268
TspDTI ATGAA 1 cut(s) 219
TspRI CASTG 2 cut(s) 67, 268
VpaK11BI GGWCC 2 cut(s) 142, 156
XcmI CCANNNNNNNNNTGG 1 cut(s) 136
XspI CTAG 2 cut(s) 5, 313
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.