Rh4BG216000

Gibberellin 3-beta-dioxygenase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
37585799 .. 37586404
606 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG216000.1

Sequence Viewer

Length: 300 bp
ATGCCAAGGTCCCTCATGTATGAGAGTTTTGGCCTTGAGGAAGCCTCCAACTATGAATCCCTTAAAAACTTGATAGAAGAAATGTGGCCTAACGGTCATGACCAGTTTTGCACTGTAATTTCTATGCTGAAGCAACTGGAGGAACTGAAGGATATGATTAACTTGAAGATTCTTGATAGTTATGGTATGGAGGATAAATCAAACTCGATCCTGGAGTCTAAGACACTACTACGACCAATGAAATACATGCCACCTCCTTCGAAGGATTACACGACAGGGCTCACAGCTCACACTGAATAA

Protein Analysis

99

Amino Acids

11.47

Weight (kDa)

4.87

Isoelectric Point (pI)

60.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019920)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0418431
rosa_multiflora Rmu_co8108702.1_g000001 Rmu_sc0001266.1_g000007
rosa_roxburghii Rroxscaffold_5G00361660
rosa_rugosa Rorug04G0153000
rosa_samantha Rh4BG216000 Rh5CG319300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 202
AcuI CTGAAG 2 cut(s) 149, 167
AgsI TTSAA 1 cut(s) 166
AjnI CCWGG 1 cut(s) 210
AluBI AGCT 1 cut(s) 287
AluI AGCT 1 cut(s) 287
AlwI GGATC 1 cut(s) 202
AoxI GGCC 2 cut(s) 31, 86
AspS9I GGNCC 1 cut(s) 9
AsuII TTCGAA 1 cut(s) 260
AvaII GGWCC 1 cut(s) 9
BanII GRGCYC 1 cut(s) 282
BciT130I CCWGG 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 9
BmgT120I GGNCC 1 cut(s) 9
BmiI GGNNCC 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 212
BplI GAGNNNNNCTC 2 cut(s) 29, 61
BpmI CTGGAG 2 cut(s) 158, 233
Bpu14I TTCGAA 1 cut(s) 260
BpuEI CTTGAG 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 5
Bse1I ACTGG 2 cut(s) 103, 141
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 1 cut(s) 5
BseNI ACTGG 2 cut(s) 103, 141
BshFI GGCC 2 cut(s) 33, 88
BsnI GGCC 2 cut(s) 33, 88
Bsp119I TTCGAA 1 cut(s) 260
Bsp1286I GDGCHC 1 cut(s) 282
Bsp143I GATC 1 cut(s) 207
BspANI GGCC 2 cut(s) 33, 88
BspHI TCATGA 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 11
BspPI GGATC 1 cut(s) 202
BspT104I TTCGAA 1 cut(s) 260
BsrI ACTGG 2 cut(s) 103, 141
BssECI CCNNGG 1 cut(s) 5
BssMI GATC 1 cut(s) 207
BssT1I CCWWGG 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 212
Bst4CI ACNGT 2 cut(s) 95, 115
BstBI TTCGAA 1 cut(s) 260
BstDEI CTNAG 1 cut(s) 219
BstKTI GATC 1 cut(s) 210
BstMBI GATC 1 cut(s) 207
BstNI CCWGG 1 cut(s) 212
BstNSI RCATGY 1 cut(s) 250
BstSCI CCNGG 1 cut(s) 210
BsuRI GGCC 2 cut(s) 33, 88
BtsIMutI CAGTG 2 cut(s) 111, 291
CciI TCATGA 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 9
CviAII CATG 3 cut(s) 16, 98, 247
CviJI RGCY 5 cut(s) 33, 44, 88, 280, 287
CviKI_1 RGCY 5 cut(s) 33, 44, 88, 280, 287
DdeI CTNAG 1 cut(s) 219
DpnI GATC 1 cut(s) 209
DpnII GATC 1 cut(s) 207
Eco130I CCWWGG 1 cut(s) 5
Eco24I GRGCYC 1 cut(s) 282
Eco47I GGWCC 1 cut(s) 9
Eco57I CTGAAG 2 cut(s) 149, 167
EcoO109I RGGNCCY 1 cut(s) 9
EcoRII CCWGG 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 5
EcoT38I GRGCYC 1 cut(s) 282
ErhI CCWWGG 1 cut(s) 5
FaeI CATG 3 cut(s) 19, 101, 250
FaiI YATR 9 cut(s) 17, 21, 54, 99, 125, 155, 183, 188, 248
FatI CATG 3 cut(s) 15, 97, 246
FriOI GRGCYC 1 cut(s) 282
GsuI CTGGAG 2 cut(s) 158, 233
HaeIII GGCC 2 cut(s) 33, 88
Hin1II CATG 3 cut(s) 19, 101, 250
HinfI GANTC 3 cut(s) 56, 169, 215
Hpy188III TCNNGA 2 cut(s) 98, 173
HpyAV CCTTC 3 cut(s) 142, 256, 267
HpyCH4III ACNGT 2 cut(s) 95, 115
HpyCH4V TGCA 1 cut(s) 111
HpyF3I CTNAG 1 cut(s) 219
Hsp92II CATG 3 cut(s) 19, 101, 250
Kzo9I GATC 1 cut(s) 207
LpnPI CCDG 5 cut(s) 116, 122, 197, 224, 261
MalI GATC 1 cut(s) 209
MboI GATC 1 cut(s) 207
MboII GAAGA 2 cut(s) 89, 178
MhlI GDGCHC 1 cut(s) 282
MluCI AATT 1 cut(s) 117
MlyI GAGTC 1 cut(s) 224
MmeI TCCRAC 1 cut(s) 72
MnlI CCTC 6 cut(s) 23, 31, 55, 133, 184, 264
MseI TTAA 2 cut(s) 63, 159
MspR9I CCNGG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 212
NdeII GATC 1 cut(s) 207
NlaIII CATG 3 cut(s) 19, 101, 250
NlaIV GGNNCC 1 cut(s) 11
NspI RCATGY 1 cut(s) 250
NspV TTCGAA 1 cut(s) 260
PagI TCATGA 1 cut(s) 97
PfeI GAWTC 2 cut(s) 56, 169
PfoI TCCNGGA 1 cut(s) 210
PleI GAGTC 1 cut(s) 223
PpsI GAGTC 1 cut(s) 223
PpuMI RGGWCCY 1 cut(s) 9
Psp5II RGGWCCY 1 cut(s) 9
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspN4I GGNNCC 1 cut(s) 11
PspPI GGNCC 1 cut(s) 9
PspPPI RGGWCCY 1 cut(s) 9
SaqAI TTAA 2 cut(s) 63, 159
Sau3AI GATC 1 cut(s) 207
Sau96I GGNCC 1 cut(s) 9
SchI GAGTC 1 cut(s) 224
ScrFI CCNGG 1 cut(s) 212
SduI GDGCHC 1 cut(s) 282
SetI ASST 3 cut(s) 11, 256, 289
SfuI TTCGAA 1 cut(s) 260
SinI GGWCC 1 cut(s) 9
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
Sse9I AATT 1 cut(s) 117
StyD4I CCNGG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 5
TaaI ACNGT 2 cut(s) 95, 115
TaqI TCGA 2 cut(s) 206, 260
TasI AATT 1 cut(s) 117
TfiI GAWTC 2 cut(s) 56, 169
Tru1I TTAA 2 cut(s) 63, 159
Tru9I TTAA 2 cut(s) 63, 159
TscAI CASTG 2 cut(s) 118, 298
TspDTI ATGAA 2 cut(s) 69, 254
TspRI CASTG 2 cut(s) 118, 298
VpaK11BI GGWCC 1 cut(s) 9
XceI RCATGY 1 cut(s) 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.