Rroxscaffold_6G00404520

disease resistance RPP13-like protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
27012659 .. 27022703
10045 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00404520.1

Sequence Viewer

Length: 303 bp
ATGGATTGTCAATGGACGACTGTCCAAATGGTGCATCTAAAGTTGTTGGATGAACTGCAGATGGATTGGGGAAAACTGCAAGGCTTGTTTCCGAACTTGAGTTACTTGGAGATATTCAAATGTCCCAAACTTAGTTTCGACCAATGTGATGAGAATGGAGTGTGGAAAAGGGAAGACTCAGAACAAGGAGAAGCATCGAGTAGTACATTTCATATTCCATTTATTGTTTCTACTGACGCTTGTTCAAAACAAGTTCTTGGTTCCGACTGTACTAATGCTTATTGTTGGAACAATCAAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.47

Weight (kDa)

4.49

Isoelectric Point (pI)

44.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 205, 271
AgsI TTSAA 2 cut(s) 118, 246
AjuI GAANNNNNNNTTGG 2 cut(s) 119, 151
BbsI GAAGAC 1 cut(s) 180
BccI CCATC 1 cut(s) 55
BfmI CTRYAG 1 cut(s) 56
BmiI GGNNCC 1 cut(s) 262
BmsI GCATC 2 cut(s) 43, 203
BoxI GACNNNNGTC 1 cut(s) 20
BpiI GAAGAC 1 cut(s) 180
BpuEI CTTGAG 1 cut(s) 118
BseGI GGATG 1 cut(s) 55
BseMII CTCAG 1 cut(s) 192
BslFI GGGAC 1 cut(s) 108
BsmFI GGGAC 1 cut(s) 108
BspCNI CTCAG 1 cut(s) 191
BspLI GGNNCC 1 cut(s) 262
BspMAI CTGCAG 1 cut(s) 60
Bst4CI ACNGT 2 cut(s) 22, 269
BstDEI CTNAG 2 cut(s) 131, 178
BstF5I GGATG 1 cut(s) 55
BstPAI GACNNNNGTC 1 cut(s) 20
BstSFI CTRYAG 1 cut(s) 56
BstV2I GAAGAC 1 cut(s) 180
BtsCI GGATG 1 cut(s) 55
CseI GACGC 1 cut(s) 245
Csp6I GTAC 2 cut(s) 204, 270
CviJI RGCY 1 cut(s) 84
CviKI_1 RGCY 1 cut(s) 84
CviQI GTAC 2 cut(s) 204, 270
DdeI CTNAG 2 cut(s) 131, 178
FaiI YATR 1 cut(s) 213
FaqI GGGAC 1 cut(s) 108
FokI GGATG 1 cut(s) 62
HgaI GACGC 1 cut(s) 245
HinfI GANTC 1 cut(s) 176
Hpy188I TCNGA 3 cut(s) 93, 181, 265
HpyCH4III ACNGT 2 cut(s) 22, 269
HpyCH4V TGCA 3 cut(s) 34, 58, 79
HpyF3I CTNAG 2 cut(s) 131, 178
LweI GCATC 2 cut(s) 43, 203
MaeIII GTNAC 1 cut(s) 101
MboII GAAGA 1 cut(s) 185
MlyI GAGTC 1 cut(s) 170
MmeI TCCRAC 3 cut(s) 27, 266, 288
NlaIV GGNNCC 1 cut(s) 262
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
PshAI GACNNNNGTC 1 cut(s) 20
PspN4I GGNNCC 1 cut(s) 262
PsrI GAACNNNNNNTAC 2 cut(s) 86, 118
PstI CTGCAG 1 cut(s) 60
RsaI GTAC 2 cut(s) 205, 271
RsaNI GTAC 2 cut(s) 204, 270
SchI GAGTC 1 cut(s) 170
SfaNI GCATC 2 cut(s) 43, 203
SfcI CTRYAG 1 cut(s) 56
SgeI CNNG 9 cut(s) 92, 97, 109, 118, 197, 210, 252, 263, 269
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
TaaI ACNGT 2 cut(s) 22, 269
TaqI TCGA 2 cut(s) 138, 197
TatI WGTACW 2 cut(s) 203, 269
TspDTI ATGAA 2 cut(s) 66, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.