Rroxscaffold_6G00411980

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
OG0020131
Physical Location & Seq
Forward (+)
34578993 .. 34580434
1442 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00411980.1

Sequence Viewer

Length: 600 bp
ATGCAAATCTTCGTGAAAACCCTCACCGGCAAGACCATCACTCTCGAGGTTGAGAGCTCCGACACCATCGACAACGTCAAGGCTAAGATCCAGGACAAGGAGGGAATTCCCCCGGACCAGCAGAGGTTGATCTTCGCCGGAAAGCAATTGGAGGACGGCAGGACCCTGGCCGATTACAACATCCAGAAGGAGTCCACTCTCCACTTGGTGCTCCGGTTGAGGGGTGGTATGCAGATTTTCGTCAAGACTTTGACAGGGAAGACCATCACCCTGGAGGTGGAGAGCTCCGACACGATCGACAATGTCAAGGCCAAGATTCAGGATAAGGAGGGGATTCCCCCGGATCAGCAGAGGTTGATCTTTGCCGGAAAGCAGTTGGAGGATGGCAGGACTCTGGCGGATTACAATATCCAGAAGGAGTCCACTCTTCATCTGGTCCTCAGGCTTCGCGGAGGTATGCAGATTTTCGTGAAGACTCTGACTGGCAAGACAATTACTCTGGAGGTGGAGAGCTCCGATACCATTGATAATGTCAAAGCCAAGATCCAGGATAAGGAAGGGGATCCCACCGGACCAGCAGAGGCTGATCTTTGCGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

199

Amino Acids

22.02

Weight (kDa)

5.35

Isoelectric Point (pI)

24.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 1 - 71 2.6e-17 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 3 - 74 3.2e-32 Ubiquitin family
Rad60-SLD PF11976 77 - 147 2.6e-17 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 79 - 150 3.2e-32 Ubiquitin family
ubiquitin PF00240 155 - 187 3.6e-09 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020131)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g21853 FvH4_3g21921 FvH4_3g21922
prunus_persica Prupe.4G025900_v2.0.a1
pyrus_communis pycom03g15910
rosa_roxburghii Rroxscaffold_6G00411980

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 450
AciI CCGC 3 cut(s) 398, 450, 594
AclWI GGATC 5 cut(s) 82, 351, 538, 557, 570
AcoI YGGCCR 1 cut(s) 168
AcsI RAATTY 1 cut(s) 105
AdeI CACNNNGTG 1 cut(s) 208
AfiI CCNNNNNNNGG 4 cut(s) 97, 220, 277, 553
AjnI CCWGG 4 cut(s) 90, 165, 270, 546
AluBI AGCT 3 cut(s) 57, 285, 513
AluI AGCT 3 cut(s) 57, 285, 513
Alw21I GWGCWC 4 cut(s) 59, 213, 287, 515
AlwI GGATC 5 cut(s) 82, 351, 538, 557, 570
AlwNI CAGNNNCTG 1 cut(s) 584
Ama87I CYCGRG 1 cut(s) 44
AoxI GGCC 2 cut(s) 168, 309
ApoI RAATTY 1 cut(s) 105
AspS9I GGNCC 4 cut(s) 115, 162, 436, 572
AsuC2I CCSGG 2 cut(s) 113, 341
AsuHPI GGTGA 2 cut(s) 16, 259
AvaI CYCGRG 1 cut(s) 44
AvaII GGWCC 4 cut(s) 115, 162, 436, 572
AxyI CCTNAGG 1 cut(s) 440
BamHI GGATCC 1 cut(s) 562
BanII GRGCYC 3 cut(s) 59, 287, 515
BbsI GAAGAC 2 cut(s) 266, 479
Bbv12I GWGCWC 4 cut(s) 59, 213, 287, 515
BccI CCATC 4 cut(s) 44, 74, 272, 377
BceAI ACGGC 1 cut(s) 172
BciT130I CCWGG 4 cut(s) 92, 167, 272, 548
BcnI CCSGG 2 cut(s) 113, 341
Bme1390I CCNGG 6 cut(s) 92, 113, 167, 272, 341, 548
Bme18I GGWCC 4 cut(s) 115, 162, 436, 572
BmeT110I CYCGRG 1 cut(s) 44
BmgT120I GGNCC 4 cut(s) 115, 162, 436, 572
BmiI GGNNCC 2 cut(s) 164, 564
BmrFI CCNGG 6 cut(s) 92, 113, 167, 272, 341, 548
BpiI GAAGAC 2 cut(s) 266, 479
BpmI CTGGAG 2 cut(s) 293, 521
BpuMI CCSGG 2 cut(s) 113, 341
BsaJI CCNNGG 4 cut(s) 111, 165, 270, 339
BsaWI WCCGGW 2 cut(s) 213, 569
Bsc4I CCNNNNNNNGG 4 cut(s) 97, 220, 277, 553
Bse118I RCCGGY 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 487
Bse21I CCTNAGG 1 cut(s) 440
BseBI CCWGG 4 cut(s) 92, 167, 272, 548
BseDI CCNNGG 4 cut(s) 111, 165, 270, 339
BseGI GGATG 2 cut(s) 180, 388
BseLI CCNNNNNNNGG 4 cut(s) 97, 220, 277, 553
BseMII CTCAG 1 cut(s) 454
BseNI ACTGG 1 cut(s) 487
Bsh1236I CGCG 1 cut(s) 450
Bsh1285I CGRYCG 1 cut(s) 297
BshFI GGCC 2 cut(s) 170, 311
BsiEI CGRYCG 1 cut(s) 297
BsiHKAI GWGCWC 4 cut(s) 59, 213, 287, 515
BsiHKCI CYCGRG 1 cut(s) 44
BsiSI CCGG 7 cut(s) 27, 113, 138, 214, 341, 366, 570
BslI CCNNNNNNNGG 4 cut(s) 97, 220, 277, 553
BsnI GGCC 2 cut(s) 170, 311
BsoBI CYCGRG 1 cut(s) 44
Bsp1286I GDGCHC 4 cut(s) 59, 213, 287, 515
Bsp143I GATC 8 cut(s) 87, 129, 294, 343, 357, 543, 562, 586
BspACI CCGC 3 cut(s) 398, 450, 594
BspANI GGCC 2 cut(s) 170, 311
BspCNI CTCAG 1 cut(s) 453
BspFNI CGCG 1 cut(s) 450
BspLI GGNNCC 2 cut(s) 164, 564
BspPI GGATC 5 cut(s) 82, 351, 538, 557, 570
BsrFI RCCGGY 1 cut(s) 26
BsrI ACTGG 1 cut(s) 487
BssAI RCCGGY 1 cut(s) 26
BssECI CCNNGG 4 cut(s) 111, 165, 270, 339
BssMI GATC 8 cut(s) 87, 129, 294, 343, 357, 543, 562, 586
Bst2UI CCWGG 4 cut(s) 92, 167, 272, 548
Bst6I CTCTTC 1 cut(s) 432
BstDEI CTNAG 2 cut(s) 84, 440
BstF5I GGATG 2 cut(s) 180, 388
BstFNI CGCG 1 cut(s) 450
BstKTI GATC 8 cut(s) 90, 132, 297, 346, 360, 546, 565, 589
BstMBI GATC 8 cut(s) 87, 129, 294, 343, 357, 543, 562, 586
BstMCI CGRYCG 1 cut(s) 297
BstNI CCWGG 4 cut(s) 92, 167, 272, 548
BstSCI CCNGG 6 cut(s) 90, 111, 165, 270, 339, 546
BstUI CGCG 1 cut(s) 450
BstV2I GAAGAC 2 cut(s) 266, 479
BstX2I RGATCY 3 cut(s) 87, 543, 562
BstXI CCANNNNNNTGG 1 cut(s) 271
BstYI RGATCY 3 cut(s) 87, 543, 562
Bsu36I CCTNAGG 1 cut(s) 440
BsuRI GGCC 2 cut(s) 170, 311
BtsCI GGATG 2 cut(s) 180, 388
CaiI CAGNNNCTG 1 cut(s) 584
Cfr10I RCCGGY 1 cut(s) 26
Cfr13I GGNCC 4 cut(s) 115, 162, 436, 572
CviJI RGCY 9 cut(s) 57, 83, 170, 285, 311, 445, 513, 539, 584
CviKI_1 RGCY 9 cut(s) 57, 83, 170, 285, 311, 445, 513, 539, 584
DdeI CTNAG 2 cut(s) 84, 440
DpnI GATC 8 cut(s) 89, 131, 296, 345, 359, 545, 564, 588
DpnII GATC 8 cut(s) 87, 129, 294, 343, 357, 543, 562, 586
DraIII CACNNNGTG 1 cut(s) 208
EaeI YGGCCR 1 cut(s) 168
Eam1104I CTCTTC 1 cut(s) 432
EarI CTCTTC 1 cut(s) 432
EciI GGCGGA 1 cut(s) 413
Ecl136II GAGCTC 3 cut(s) 57, 285, 513
Eco24I GRGCYC 3 cut(s) 59, 287, 515
Eco47I GGWCC 4 cut(s) 115, 162, 436, 572
Eco53kI GAGCTC 3 cut(s) 57, 285, 513
Eco81I CCTNAGG 1 cut(s) 440
Eco88I CYCGRG 1 cut(s) 44
EcoICRI GAGCTC 3 cut(s) 57, 285, 513
EcoO109I RGGNCCY 1 cut(s) 162
EcoRI GAATTC 1 cut(s) 105
EcoRII CCWGG 4 cut(s) 90, 165, 270, 546
EcoT38I GRGCYC 3 cut(s) 59, 287, 515
FaiI YATR 2 cut(s) 230, 458
FauI CCCGC 1 cut(s) 587
FokI GGATG 2 cut(s) 167, 395
FriOI GRGCYC 3 cut(s) 59, 287, 515
GsuI CTGGAG 2 cut(s) 293, 521
HaeIII GGCC 2 cut(s) 170, 311
HapII CCGG 7 cut(s) 27, 113, 138, 214, 341, 366, 570
HinfI GANTC 6 cut(s) 191, 316, 334, 391, 419, 475
HpaII CCGG 7 cut(s) 27, 113, 138, 214, 341, 366, 570
HphI GGTGA 2 cut(s) 16, 259
Hpy166II GTNNAC 2 cut(s) 195, 423
Hpy188I TCNGA 4 cut(s) 61, 289, 480, 517
Hpy188III TCNNGA 8 cut(s) 13, 44, 184, 244, 320, 412, 469, 500
Hpy8I GTNNAC 2 cut(s) 195, 423
HpyAV CCTTC 3 cut(s) 181, 409, 551
HpyCH4IV ACGT 1 cut(s) 75
HpyCH4V TGCA 3 cut(s) 4, 232, 460
HpyF3I CTNAG 2 cut(s) 84, 440
HpySE526I ACGT 1 cut(s) 75
Kzo9I GATC 8 cut(s) 87, 129, 294, 343, 357, 543, 562, 586
LmnI GCTCC 4 cut(s) 62, 216, 290, 518
MaeII ACGT 1 cut(s) 75
MalI GATC 8 cut(s) 89, 131, 296, 345, 359, 545, 564, 588
MboI GATC 8 cut(s) 87, 129, 294, 343, 357, 543, 562, 586
MboII GAAGA 4 cut(s) 124, 271, 419, 484
MfeI CAATTG 1 cut(s) 146
MflI RGATCY 3 cut(s) 87, 543, 562
MhlI GDGCHC 4 cut(s) 59, 213, 287, 515
MluCI AATT 3 cut(s) 105, 146, 492
MlyI GAGTC 4 cut(s) 200, 385, 428, 469
MmeI TCCRAC 3 cut(s) 84, 312, 357
MspI CCGG 7 cut(s) 27, 113, 138, 214, 341, 366, 570
MspR9I CCNGG 6 cut(s) 92, 113, 167, 272, 341, 548
MunI CAATTG 1 cut(s) 146
MvaI CCWGG 4 cut(s) 92, 167, 272, 548
MvnI CGCG 1 cut(s) 450
NciI CCSGG 2 cut(s) 113, 341
NdeII GATC 8 cut(s) 87, 129, 294, 343, 357, 543, 562, 586
NlaIV GGNNCC 2 cut(s) 164, 564
PaeR7I CTCGAG 1 cut(s) 44
PfeI GAWTC 2 cut(s) 316, 334
PflFI GACNNNGTC 2 cut(s) 74, 302
PfoI TCCNGGA 2 cut(s) 90, 546
Ple19I CGATCG 1 cut(s) 297
PleI GAGTC 4 cut(s) 199, 385, 427, 469
PpsI GAGTC 4 cut(s) 199, 385, 427, 469
PpuMI RGGWCCY 1 cut(s) 162
Psp124BI GAGCTC 3 cut(s) 59, 287, 515
Psp5II RGGWCCY 1 cut(s) 162
Psp6I CCWGG 4 cut(s) 90, 165, 270, 546
PspGI CCWGG 4 cut(s) 90, 165, 270, 546
PspN4I GGNNCC 2 cut(s) 164, 564
PspPI GGNCC 4 cut(s) 115, 162, 436, 572
PspPPI RGGWCCY 1 cut(s) 162
PstNI CAGNNNCTG 1 cut(s) 584
PsuI RGATCY 3 cut(s) 87, 543, 562
PsyI GACNNNGTC 2 cut(s) 74, 302
PvuI CGATCG 1 cut(s) 297
SacI GAGCTC 3 cut(s) 59, 287, 515
Sau3AI GATC 8 cut(s) 87, 129, 294, 343, 357, 543, 562, 586
Sau96I GGNCC 4 cut(s) 115, 162, 436, 572
SchI GAGTC 4 cut(s) 200, 385, 428, 469
ScrFI CCNGG 6 cut(s) 92, 113, 167, 272, 341, 548
SduI GDGCHC 4 cut(s) 59, 213, 287, 515
Sfr274I CTCGAG 1 cut(s) 44
SinI GGWCC 4 cut(s) 115, 162, 436, 572
SlaI CTCGAG 1 cut(s) 44
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
Sse9I AATT 3 cut(s) 105, 146, 492
SsiI CCGC 3 cut(s) 398, 450, 594
SstI GAGCTC 3 cut(s) 59, 287, 515
StyD4I CCNGG 6 cut(s) 90, 111, 165, 270, 339, 546
TaiI ACGT 1 cut(s) 78
TaqI TCGA 3 cut(s) 45, 69, 297
TasI AATT 3 cut(s) 105, 146, 492
TfiI GAWTC 2 cut(s) 316, 334
TspDTI ATGAA 1 cut(s) 419
Tth111I GACNNNGTC 2 cut(s) 74, 302
VpaK11BI GGWCC 4 cut(s) 115, 162, 436, 572
XapI RAATTY 1 cut(s) 105
XcmI CCANNNNNNNNNTGG 2 cut(s) 202, 430
XhoI CTCGAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.