FvH4_3g21853

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0011635
Physical Location & Seq
Forward (+)
14928566 .. 14932041
3476 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g21853.t6

Sequence Viewer

Length: 918 bp
ATGCAGATCTTTGTGAAAACCCTCACAGGCAAGACTATCACCCTCGAGGTTGAAAGCTCTGACACTATTGACAATGTCAAGGCAAAGATCCAAGACAAGGAGGGAATCCCCCCAGACCAGCAAAGGCTGATCTTTGCTGGCAAGCAGCTCGAGGACGGCCGAACACTTGCTGACTACAACATTCAAAAAGAGTCCACCCTCCACCTGGTGCTTAGACTCCGTGGTGGCATGCAGATCTTTGTCAAGACTCTCACAGGGAAGACCATCACATTGGAGGTTGAGAGCTCTGACACAATCGATAATGTCAAGGCAAAGATTCAGGACAAGGAGGGCATCCCCCCAGATCAGCAGAGGCTCATCTTTGCCGGCAAACAGCTAGAGGATGGCCGTACGCTCGCAGATTACAATATCCAAAAAGAGTCCACCCTCCACCTGGTGCTCCGTCTTCGTGGTGGAATGCAAATCTTTGTGAAGACCCTTACTGGGAAGACAATCACATTGGAGGTGGAAAGCTCTGATACAATTGACAATGTTAAAGCAAAGATCCAGGACAAGGAGGGTATTCCCCCAGATCAGCAGAGGCTCATCTTTGCAGGAAAGCAGCTTGAGGATGGTAGGACACTGGCAGATTACAACATACAGAAGGAGTCAACTCTGCATTTGGTGCTCCGTCTACGTGGTGGGATGCAGATCTTTGTGAAGACCCTCACTGGAAAGACCATAACCTTGGAGGTAGAGAGTTCTGATACAATTGATAATGTGAAAGCAAAGATTCAGGACAAGGAGGGCATTCCTCCGGACCAGCAGAGGCTCATATTTGCTGGTAAGCAGCTTGAAGATGGCCGGACTCTAGCAGATTACAATATTCAAAAGGAGTCAACCCTTCACCTCGTCCTTCGCCTCCGTGGTGGTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

306

Amino Acids

34.19

Weight (kDa)

6.94

Isoelectric Point (pI)

29.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 1 - 71 3.4e-17 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 3 - 74 4.3e-32 Ubiquitin family
Rad60-SLD PF11976 77 - 147 3.4e-17 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 79 - 150 4.3e-32 Ubiquitin family
Rad60-SLD PF11976 153 - 223 3.4e-17 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 155 - 226 4.3e-32 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 44
AccI GTMKAC 1 cut(s) 673
AccIII TCCGGA 1 cut(s) 796
AclWI GGATC 2 cut(s) 82, 538
AcoI YGGCCR 3 cut(s) 157, 385, 841
AdeI CACNNNGTG 2 cut(s) 208, 436
AfaI GTAC 1 cut(s) 391
AfiI CCNNNNNNNGG 5 cut(s) 97, 205, 433, 483, 553
AgsI TTSAA 4 cut(s) 53, 185, 836, 869
AjnI CCWGG 3 cut(s) 204, 432, 546
AluBI AGCT 7 cut(s) 57, 148, 285, 376, 513, 604, 832
AluI AGCT 7 cut(s) 57, 148, 285, 376, 513, 604, 832
Alw21I GWGCWC 3 cut(s) 287, 441, 669
AlwI GGATC 2 cut(s) 82, 538
Ama87I CYCGRG 2 cut(s) 44, 149
Aor13HI TCCGGA 1 cut(s) 796
AoxI GGCC 3 cut(s) 157, 385, 841
ApeKI GCWGC 3 cut(s) 145, 601, 829
AspS9I GGNCC 1 cut(s) 799
AsuHPI GGTGA 2 cut(s) 31, 878
AvaI CYCGRG 2 cut(s) 44, 149
AvaII GGWCC 1 cut(s) 799
BanII GRGCYC 1 cut(s) 287
BbsI GAAGAC 5 cut(s) 266, 437, 479, 494, 707
Bbv12I GWGCWC 3 cut(s) 287, 441, 669
BbvI GCAGC 3 cut(s) 157, 613, 841
BccI CCATC 4 cut(s) 272, 377, 605, 833
BceAI ACGGC 2 cut(s) 172, 372
BcgI CGANNNNNNTGC 2 cut(s) 130, 164
BciT130I CCWGG 3 cut(s) 206, 434, 548
BfaI CTAG 2 cut(s) 377, 851
BglII AGATCT 3 cut(s) 6, 234, 690
BisI GCNGC 3 cut(s) 146, 602, 830
BlsI GCNGC 3 cut(s) 147, 603, 831
Bme1390I CCNGG 3 cut(s) 206, 434, 548
Bme18I GGWCC 1 cut(s) 799
BmeT110I CYCGRG 2 cut(s) 44, 149
BmgT120I GGNCC 1 cut(s) 799
BmrFI CCNGG 3 cut(s) 206, 434, 548
BmrI ACTGGG 1 cut(s) 492
BmsI GCATC 2 cut(s) 342, 675
BmuI ACTGGG 1 cut(s) 492
BpiI GAAGAC 5 cut(s) 266, 437, 479, 494, 707
BpuEI CTTGAG 1 cut(s) 626
Bsa29I ATCGAT 1 cut(s) 297
BsaAI YACGTR 1 cut(s) 677
BsaBI GATNNNNATC 1 cut(s) 689
BsaJI CCNNGG 3 cut(s) 220, 726, 904
BsaWI WCCGGW 1 cut(s) 796
Bsc4I CCNNNNNNNGG 5 cut(s) 97, 205, 433, 483, 553
Bse118I RCCGGY 1 cut(s) 365
Bse1I ACTGG 3 cut(s) 487, 627, 715
Bse8I GATNNNNATC 1 cut(s) 689
BseAI TCCGGA 1 cut(s) 796
BseBI CCWGG 3 cut(s) 206, 434, 548
BseCI ATCGAT 1 cut(s) 297
BseDI CCNNGG 3 cut(s) 220, 726, 904
BseGI GGATG 4 cut(s) 333, 388, 616, 690
BseJI GATNNNNATC 1 cut(s) 689
BseLI CCNNNNNNNGG 5 cut(s) 97, 205, 433, 483, 553
BseNI ACTGG 3 cut(s) 487, 627, 715
BseX3I CGGCCG 1 cut(s) 157
BseXI GCAGC 3 cut(s) 157, 613, 841
Bsh1285I CGRYCG 1 cut(s) 160
BshFI GGCC 3 cut(s) 159, 387, 843
BshVI ATCGAT 1 cut(s) 297
BsiEI CGRYCG 1 cut(s) 160
BsiHKAI GWGCWC 3 cut(s) 287, 441, 669
BsiHKCI CYCGRG 2 cut(s) 44, 149
BsiSI CCGG 3 cut(s) 366, 797, 844
BsiWI CGTACG 1 cut(s) 389
BslI CCNNNNNNNGG 5 cut(s) 97, 205, 433, 483, 553
BsmI GAATGC 2 cut(s) 462, 789
BsnI GGCC 3 cut(s) 159, 387, 843
BsoBI CYCGRG 2 cut(s) 44, 149
Bsp1286I GDGCHC 3 cut(s) 287, 441, 669
Bsp13I TCCGGA 1 cut(s) 796
Bsp143I GATC 8 cut(s) 6, 87, 129, 234, 343, 543, 571, 690
BspANI GGCC 3 cut(s) 159, 387, 843
BspDI ATCGAT 1 cut(s) 297
BspEI TCCGGA 1 cut(s) 796
BspPI GGATC 2 cut(s) 82, 538
BsrFI RCCGGY 1 cut(s) 365
BsrI ACTGG 3 cut(s) 487, 627, 715
BssAI RCCGGY 1 cut(s) 365
BssECI CCNNGG 3 cut(s) 220, 726, 904
BssMI GATC 8 cut(s) 6, 87, 129, 234, 343, 543, 571, 690
BssT1I CCWWGG 1 cut(s) 726
Bst2UI CCWGG 3 cut(s) 206, 434, 548
BstAPI GCANNNNNTGC 1 cut(s) 664
BstBAI YACGTR 1 cut(s) 677
BstC8I GCNNGC 5 cut(s) 139, 143, 230, 367, 396
BstDEI CTNAG 1 cut(s) 212
BstDSI CCRYGG 2 cut(s) 220, 904
BstF5I GGATG 4 cut(s) 333, 388, 616, 690
BstKTI GATC 8 cut(s) 9, 90, 132, 237, 346, 546, 574, 693
BstMBI GATC 8 cut(s) 6, 87, 129, 234, 343, 543, 571, 690
BstMCI CGRYCG 1 cut(s) 160
BstMWI GCNNNNNNNGC 1 cut(s) 664
BstNI CCWGG 3 cut(s) 206, 434, 548
BstNSI RCATGY 1 cut(s) 232
BstSCI CCNGG 3 cut(s) 204, 432, 546
BstV1I GCAGC 3 cut(s) 157, 613, 841
BstV2I GAAGAC 5 cut(s) 266, 437, 479, 494, 707
BstX2I RGATCY 5 cut(s) 6, 87, 234, 543, 690
BstXI CCANNNNNNTGG 2 cut(s) 271, 727
BstYI RGATCY 5 cut(s) 6, 87, 234, 543, 690
BstZI CGGCCG 1 cut(s) 157
Bsu15I ATCGAT 1 cut(s) 297
BsuRI GGCC 3 cut(s) 159, 387, 843
BsuTUI ATCGAT 1 cut(s) 297
BtgI CCRYGG 2 cut(s) 220, 904
BtsCI GGATG 4 cut(s) 333, 388, 616, 690
BtsIMutI CAGTG 2 cut(s) 620, 708
Cac8I GCNNGC 5 cut(s) 139, 143, 230, 367, 396
Cfr10I RCCGGY 1 cut(s) 365
Cfr13I GGNCC 1 cut(s) 799
ClaI ATCGAT 1 cut(s) 297
CsiI ACCWGGT 2 cut(s) 204, 432
Csp6I GTAC 1 cut(s) 390
CviAII CATG 1 cut(s) 229
CviQI GTAC 1 cut(s) 390
DdeI CTNAG 1 cut(s) 212
DpnI GATC 8 cut(s) 8, 89, 131, 236, 345, 545, 573, 692
DpnII GATC 8 cut(s) 6, 87, 129, 234, 343, 543, 571, 690
DraIII CACNNNGTG 2 cut(s) 208, 436
EaeI YGGCCR 3 cut(s) 157, 385, 841
EagI CGGCCG 1 cut(s) 157
Ecl136II GAGCTC 1 cut(s) 285
EclXI CGGCCG 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 726
Eco24I GRGCYC 1 cut(s) 287
Eco47I GGWCC 1 cut(s) 799
Eco52I CGGCCG 1 cut(s) 157
Eco53kI GAGCTC 1 cut(s) 285
Eco88I CYCGRG 2 cut(s) 44, 149
EcoICRI GAGCTC 1 cut(s) 285
EcoRII CCWGG 3 cut(s) 204, 432, 546
EcoT14I CCWWGG 1 cut(s) 726
EcoT38I GRGCYC 1 cut(s) 287
ErhI CCWWGG 1 cut(s) 726
FaeI CATG 1 cut(s) 232
FaiI YATR 4 cut(s) 230, 638, 722, 815
FatI CATG 1 cut(s) 228
FblI GTMKAC 1 cut(s) 673
Fnu4HI GCNGC 3 cut(s) 146, 602, 830
FokI GGATG 4 cut(s) 320, 395, 623, 697
FriOI GRGCYC 1 cut(s) 287
Fsp4HI GCNGC 3 cut(s) 146, 602, 830
FspBI CTAG 2 cut(s) 377, 851
GluI GCNGC 3 cut(s) 146, 602, 830
HaeIII GGCC 3 cut(s) 159, 387, 843
HapII CCGG 3 cut(s) 366, 797, 844
Hin1II CATG 1 cut(s) 232
HincII GTYRAC 2 cut(s) 651, 879
HindII GTYRAC 2 cut(s) 651, 879
HpaII CCGG 3 cut(s) 366, 797, 844
HphI GGTGA 2 cut(s) 31, 878
Hpy166II GTNNAC 5 cut(s) 195, 423, 651, 674, 879
Hpy188I TCNGA 5 cut(s) 61, 289, 517, 745, 917
Hpy188III TCNNGA 4 cut(s) 244, 320, 776, 797
Hpy8I GTNNAC 5 cut(s) 195, 423, 651, 674, 879
HpyAV CCTTC 3 cut(s) 637, 893, 905
HpyCH4IV ACGT 1 cut(s) 676
HpyCH4V TGCA 6 cut(s) 4, 232, 460, 593, 658, 688
HpyF10VI GCNNNNNNNGC 1 cut(s) 664
HpyF3I CTNAG 1 cut(s) 212
HpySE526I ACGT 1 cut(s) 676
Hsp92II CATG 1 cut(s) 232
Kpn2I TCCGGA 1 cut(s) 796
KroI GCCGGC 1 cut(s) 365
KroNI GCCGGC 1 cut(s) 367
Kzo9I GATC 8 cut(s) 6, 87, 129, 234, 343, 543, 571, 690
LmnI GCTCC 2 cut(s) 444, 672
Lsp1109I GCAGC 3 cut(s) 157, 613, 841
LweI GCATC 2 cut(s) 342, 675
MabI ACCWGGT 2 cut(s) 204, 432
MaeI CTAG 2 cut(s) 377, 851
MaeII ACGT 1 cut(s) 676
MalI GATC 8 cut(s) 8, 89, 131, 236, 345, 545, 573, 692
MboI GATC 8 cut(s) 6, 87, 129, 234, 343, 543, 571, 690
MboII GAAGA 6 cut(s) 271, 437, 484, 499, 712, 848
MfeI CAATTG 2 cut(s) 522, 750
MflI RGATCY 5 cut(s) 6, 87, 234, 543, 690
MhlI GDGCHC 3 cut(s) 287, 441, 669
MluCI AATT 2 cut(s) 522, 750
MlyI GAGTC 7 cut(s) 200, 210, 241, 428, 656, 841, 884
MroI TCCGGA 1 cut(s) 796
MroNI GCCGGC 1 cut(s) 365
MseI TTAA 1 cut(s) 534
MspI CCGG 3 cut(s) 366, 797, 844
MspR9I CCNGG 3 cut(s) 206, 434, 548
MunI CAATTG 2 cut(s) 522, 750
Mva1269I GAATGC 2 cut(s) 462, 789
MvaI CCWGG 3 cut(s) 206, 434, 548
MwoI GCNNNNNNNGC 1 cut(s) 664
NaeI GCCGGC 1 cut(s) 367
NdeII GATC 8 cut(s) 6, 87, 129, 234, 343, 543, 571, 690
NgoMIV GCCGGC 1 cut(s) 365
NlaIII CATG 1 cut(s) 232
NspI RCATGY 1 cut(s) 232
PaeI GCATGC 1 cut(s) 232
PaeR7I CTCGAG 2 cut(s) 44, 149
PctI GAATGC 2 cut(s) 462, 789
PdiI GCCGGC 1 cut(s) 367
PfeI GAWTC 3 cut(s) 105, 316, 772
Pfl23II CGTACG 1 cut(s) 389
PflFI GACNNNGTC 1 cut(s) 74
PfoI TCCNGGA 1 cut(s) 546
PkrI GCNGC 3 cut(s) 147, 603, 831
PleI GAGTC 7 cut(s) 199, 210, 241, 427, 655, 841, 883
PpsI GAGTC 7 cut(s) 199, 210, 241, 427, 655, 841, 883
Ppu21I YACGTR 1 cut(s) 677
Psp124BI GAGCTC 1 cut(s) 287
Psp6I CCWGG 3 cut(s) 204, 432, 546
PspGI CCWGG 3 cut(s) 204, 432, 546
PspLI CGTACG 1 cut(s) 389
PspPI GGNCC 1 cut(s) 799
PspXI VCTCGAGB 2 cut(s) 44, 149
PsuI RGATCY 5 cut(s) 6, 87, 234, 543, 690
PsyI GACNNNGTC 1 cut(s) 74
RsaI GTAC 1 cut(s) 391
RsaNI GTAC 1 cut(s) 390
SacI GAGCTC 1 cut(s) 287
SaqAI TTAA 1 cut(s) 534
SatI GCNGC 3 cut(s) 146, 602, 830
Sau3AI GATC 8 cut(s) 6, 87, 129, 234, 343, 543, 571, 690
Sau96I GGNCC 1 cut(s) 799
SchI GAGTC 7 cut(s) 200, 210, 241, 428, 656, 841, 884
ScrFI CCNGG 3 cut(s) 206, 434, 548
SduI GDGCHC 3 cut(s) 287, 441, 669
SexAI ACCWGGT 2 cut(s) 204, 432
SfaNI GCATC 2 cut(s) 342, 675
Sfr274I CTCGAG 2 cut(s) 44, 149
SinI GGWCC 1 cut(s) 799
SlaI CTCGAG 2 cut(s) 44, 149
SmlI CTYRAG 3 cut(s) 44, 149, 605
SmoI CTYRAG 3 cut(s) 44, 149, 605
SphI GCATGC 1 cut(s) 232
Sse9I AATT 2 cut(s) 522, 750
SspI AATATT 1 cut(s) 865
SspMI CTAG 2 cut(s) 377, 851
SstI GAGCTC 1 cut(s) 287
StyD4I CCNGG 3 cut(s) 204, 432, 546
StyI CCWWGG 1 cut(s) 726
TaiI ACGT 1 cut(s) 679
TaqI TCGA 3 cut(s) 45, 150, 297
TasI AATT 2 cut(s) 522, 750
TfiI GAWTC 3 cut(s) 105, 316, 772
Tru1I TTAA 1 cut(s) 534
Tru9I TTAA 1 cut(s) 534
TscAI CASTG 2 cut(s) 627, 715
TseI GCWGC 3 cut(s) 145, 601, 829
TspGWI ACGGA 4 cut(s) 209, 431, 659, 893
TspRI CASTG 2 cut(s) 627, 715
Tth111I GACNNNGTC 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 799
XceI RCATGY 1 cut(s) 232
XcmI CCANNNNNNNNNTGG 2 cut(s) 202, 430
XhoI CTCGAG 2 cut(s) 44, 149
XmiI GTMKAC 1 cut(s) 673
XspI CTAG 2 cut(s) 377, 851
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.