Rroxscaffold_6G00422150

RNA polymerase II-associated protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
43135023 .. 43139029
4007 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00422150.1

Sequence Viewer

Length: 204 bp
ATGGACGAAATGGATTTGGCAGTCAACATTTTGGAGAACTTAACTAAGGTTCCTAGATTTGACACACTCGTCATGTTTCTTTCATCCAACGACAAGGCTGATCTTGCCAAGATATGGGATGAAGTGTTCTACAATGAAGCAACCCCCATTGAGTTTGCTGAAAAGCTTGATAACCTGCGTACAAAGTACTGCCTTAAGCGATAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.89

Weight (kDa)

4.62

Isoelectric Point (pI)

37.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPAP3_C PF13877 5 - 32 3.2e-07 Potential Monad-binding region of RPAP3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 68
Acc36I ACCTGC 1 cut(s) 183
AccB7I CCANNNNNTGG 1 cut(s) 114
AfaI GTAC 2 cut(s) 181, 188
AfiI CCNNNNNNNGG 1 cut(s) 114
AflII CTTAAG 1 cut(s) 194
AloI GAACNNNNNNTCC 2 cut(s) 110, 142
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
BfaI CTAG 1 cut(s) 54
BfrI CTTAAG 1 cut(s) 194
BfuAI ACCTGC 1 cut(s) 183
BmcAI AGTACT 1 cut(s) 188
BmiI GGNNCC 1 cut(s) 51
Bsc4I CCNNNNNNNGG 1 cut(s) 114
BseGI GGATG 2 cut(s) 83, 124
BseLI CCNNNNNNNGG 1 cut(s) 114
BslI CCNNNNNNNGG 1 cut(s) 114
Bsp143I GATC 1 cut(s) 100
BspLI GGNNCC 1 cut(s) 51
BspMI ACCTGC 1 cut(s) 183
BspTI CTTAAG 1 cut(s) 194
BssMI GATC 1 cut(s) 100
BstAFI CTTAAG 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 45
BstF5I GGATG 2 cut(s) 83, 124
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BstMWI GCNNNNNNNGC 1 cut(s) 104
BtsCI GGATG 2 cut(s) 83, 124
BveI ACCTGC 1 cut(s) 183
Csp6I GTAC 2 cut(s) 180, 187
CviAII CATG 1 cut(s) 73
CviJI RGCY 2 cut(s) 98, 166
CviKI_1 RGCY 2 cut(s) 98, 166
CviQI GTAC 2 cut(s) 180, 187
DdeI CTNAG 1 cut(s) 45
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
DrdI GACNNNNNNGTC 1 cut(s) 68
DseDI GACNNNNNNGTC 1 cut(s) 68
FaeI CATG 1 cut(s) 76
FaiI YATR 2 cut(s) 74, 115
FatI CATG 1 cut(s) 72
FokI GGATG 2 cut(s) 70, 131
FspBI CTAG 1 cut(s) 54
Hin1II CATG 1 cut(s) 76
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HindIII AAGCTT 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 25
Hpy8I GTNNAC 1 cut(s) 25
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 45
Hsp92II CATG 1 cut(s) 76
Kzo9I GATC 1 cut(s) 100
LpnPI CCDG 1 cut(s) 188
MaeI CTAG 1 cut(s) 54
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MmeI TCCRAC 1 cut(s) 111
MseI TTAA 2 cut(s) 41, 195
MspCI CTTAAG 1 cut(s) 194
MwoI GCNNNNNNNGC 1 cut(s) 104
NdeII GATC 1 cut(s) 100
NlaIII CATG 1 cut(s) 76
NlaIV GGNNCC 1 cut(s) 51
PflMI CCANNNNNTGG 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 51
RsaI GTAC 2 cut(s) 181, 188
RsaNI GTAC 2 cut(s) 180, 187
SaqAI TTAA 2 cut(s) 41, 195
Sau3AI GATC 1 cut(s) 100
ScaI AGTACT 1 cut(s) 188
SetI ASST 3 cut(s) 51, 168, 177
SgeI CNNG 8 cut(s) 66, 80, 85, 106, 116, 121, 179, 187
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
SspMI CTAG 1 cut(s) 54
TatI WGTACW 1 cut(s) 186
Tru1I TTAA 2 cut(s) 41, 195
Tru9I TTAA 2 cut(s) 41, 195
TspDTI ATGAA 3 cut(s) 72, 135, 150
Van91I CCANNNNNTGG 1 cut(s) 114
Vha464I CTTAAG 1 cut(s) 194
XspI CTAG 1 cut(s) 54
ZrmI AGTACT 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.