Rroxscaffold_6G00423820

Mitogen-activated protein kinase kinase kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
45073470 .. 45082966
9497 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00423820.1

Sequence Viewer

Length: 216 bp
ATGCCAGATATTCCTGATTATCTTTCCCATGATGCAAAGAATTTTGTGAGGCTGTGCTTGCAATGGAACCCATCTGAGCGTGCTACTGCTTCTCAACTGCTAGACCACCCTTCCATTAGAGAGCAAATGACAACAAGAAGTTCGAACAAGTTATGGTTGTATGCAACAGAGTTTTTGTATCGTTTTACTGCCATCGTTCCTTTGTCTTTTGCTTAG

Protein Analysis

71

Amino Acids

8.3

Weight (kDa)

6.7

Isoelectric Point (pI)

54.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017830)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 40
ApoI RAATTY 1 cut(s) 40
AsuII TTCGAA 1 cut(s) 143
BccI CCATC 2 cut(s) 79, 200
BfaI CTAG 1 cut(s) 101
BmiI GGNNCC 1 cut(s) 68
BmsI GCATC 1 cut(s) 22
Bpu14I TTCGAA 1 cut(s) 143
Bse3DI GCAATG 1 cut(s) 68
BseMI GCAATG 1 cut(s) 68
BseMII CTCAG 1 cut(s) 66
Bsp119I TTCGAA 1 cut(s) 143
BspCNI CTCAG 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 68
BspT104I TTCGAA 1 cut(s) 143
BsrDI GCAATG 1 cut(s) 68
BstBI TTCGAA 1 cut(s) 143
BstC8I GCNNGC 2 cut(s) 59, 81
BstDEI CTNAG 2 cut(s) 75, 213
BstMWI GCNNNNNNNGC 1 cut(s) 58
Cac8I GCNNGC 2 cut(s) 59, 81
CviAII CATG 1 cut(s) 29
CviJI RGCY 1 cut(s) 52
CviKI_1 RGCY 1 cut(s) 52
DdeI CTNAG 2 cut(s) 75, 213
FaeI CATG 1 cut(s) 32
FaiI YATR 3 cut(s) 30, 154, 162
FatI CATG 1 cut(s) 28
FspBI CTAG 1 cut(s) 101
Hin1II CATG 1 cut(s) 32
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 1 cut(s) 14
HpyAV CCTTC 1 cut(s) 120
HpyCH4V TGCA 3 cut(s) 35, 61, 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
HpyF3I CTNAG 2 cut(s) 75, 213
Hsp92II CATG 1 cut(s) 32
LpnPI CCDG 2 cut(s) 18, 27
LweI GCATC 1 cut(s) 22
MaeI CTAG 1 cut(s) 101
MluCI AATT 1 cut(s) 40
MnlI CCTC 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 58
NlaIII CATG 1 cut(s) 32
NlaIV GGNNCC 1 cut(s) 68
NspV TTCGAA 1 cut(s) 143
PspN4I GGNNCC 1 cut(s) 68
SfaNI GCATC 1 cut(s) 22
SfuI TTCGAA 1 cut(s) 143
SgeI CNNG 8 cut(s) 17, 26, 41, 70, 92, 113, 147, 160
Sse9I AATT 1 cut(s) 40
SspMI CTAG 1 cut(s) 101
TaqI TCGA 1 cut(s) 143
TasI AATT 1 cut(s) 40
XapI RAATTY 1 cut(s) 40
XspI CTAG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.