Rh1CG074800

Sister chromatid cohesion 1 protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
15595066 .. 15597321
2256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG074800.1

Sequence Viewer

Length: 222 bp
ATGTTGTCATTCAAAGGAAGTCCTTATTGGATGGCCCCCGAGGTGGCTGCAATATTTAAGATCGGAAATAGCAAAGGTGTTGAAAACTATAGGTTTGTGGATATGAAGCAAGCTGATCCTTACGGAGATATTCTGATATGGGAACTTCCCAAATGGGAGCAAATGTCCAATGGCCTTGATAAGGCTCCAACGGCCTTTAATTATATCCTTTTGGCCCATTAG

Protein Analysis

73

Amino Acids

8.35

Weight (kDa)

5.64

Isoelectric Point (pI)

27.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017830)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 110
AfiI CCNNNNNNNGG 2 cut(s) 43, 181
AgsI TTSAA 2 cut(s) 13, 83
AjuI GAANNNNNNNTTGG 2 cut(s) 10, 42
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
AlwI GGATC 1 cut(s) 110
Ama87I CYCGRG 1 cut(s) 38
AoxI GGCC 4 cut(s) 33, 172, 192, 213
ApeKI GCWGC 1 cut(s) 47
AspS9I GGNCC 2 cut(s) 34, 214
AvaI CYCGRG 1 cut(s) 38
BbvI GCAGC 1 cut(s) 34
BccI CCATC 1 cut(s) 25
BceAI ACGGC 1 cut(s) 207
BcgI CGANNNNNNTGC 2 cut(s) 29, 63
BfmI CTRYAG 1 cut(s) 88
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
BmeT110I CYCGRG 1 cut(s) 38
BmgT120I GGNCC 2 cut(s) 34, 214
BmiI GGNNCC 2 cut(s) 36, 186
BsaJI CCNNGG 1 cut(s) 39
BsaXI ACNNNNNCTCC 2 cut(s) 149, 179
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 181
BseDI CCNNGG 1 cut(s) 39
BseGI GGATG 1 cut(s) 36
BseLI CCNNNNNNNGG 2 cut(s) 43, 181
BseXI GCAGC 1 cut(s) 34
BshFI GGCC 4 cut(s) 35, 174, 194, 215
BsiHKCI CYCGRG 1 cut(s) 38
BslI CCNNNNNNNGG 2 cut(s) 43, 181
BsnI GGCC 4 cut(s) 35, 174, 194, 215
BsoBI CYCGRG 1 cut(s) 38
Bsp143I GATC 2 cut(s) 60, 115
BspANI GGCC 4 cut(s) 35, 174, 194, 215
BspLI GGNNCC 2 cut(s) 36, 186
BspPI GGATC 1 cut(s) 110
BssECI CCNNGG 1 cut(s) 39
BssMI GATC 2 cut(s) 60, 115
BstC8I GCNNGC 1 cut(s) 111
BstENI CCTNNNNNAGG 1 cut(s) 179
BstF5I GGATG 1 cut(s) 36
BstKTI GATC 2 cut(s) 63, 118
BstMBI GATC 2 cut(s) 60, 115
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstSFI CTRYAG 1 cut(s) 88
BstV1I GCAGC 1 cut(s) 34
BsuRI GGCC 4 cut(s) 35, 174, 194, 215
BtsCI GGATG 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 111
Cfr13I GGNCC 2 cut(s) 34, 214
CviJI RGCY 7 cut(s) 35, 47, 113, 174, 185, 194, 215
CviKI_1 RGCY 7 cut(s) 35, 47, 113, 174, 185, 194, 215
DpnI GATC 2 cut(s) 62, 117
DpnII GATC 2 cut(s) 60, 115
Eco88I CYCGRG 1 cut(s) 38
EcoNI CCTNNNNNAGG 1 cut(s) 179
FaiI YATR 4 cut(s) 90, 104, 139, 204
Fnu4HI GCNGC 1 cut(s) 48
FokI GGATG 1 cut(s) 43
Fsp4HI GCNGC 1 cut(s) 48
GluI GCNGC 1 cut(s) 48
HaeIII GGCC 4 cut(s) 35, 174, 194, 215
Hpy188I TCNGA 2 cut(s) 65, 135
HpyCH4V TGCA 1 cut(s) 50
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
Kzo9I GATC 2 cut(s) 60, 115
LmnI GCTCC 2 cut(s) 157, 190
Lsp1109I GCAGC 1 cut(s) 34
MalI GATC 2 cut(s) 62, 117
MboI GATC 2 cut(s) 60, 115
MluCI AATT 1 cut(s) 199
MmeI TCCRAC 1 cut(s) 212
MnlI CCTC 1 cut(s) 34
MseI TTAA 2 cut(s) 57, 198
MwoI GCNNNNNNNGC 1 cut(s) 191
NdeII GATC 2 cut(s) 60, 115
NlaIV GGNNCC 2 cut(s) 36, 186
PkrI GCNGC 1 cut(s) 49
PspN4I GGNNCC 2 cut(s) 36, 186
PspPI GGNCC 2 cut(s) 34, 214
SaqAI TTAA 2 cut(s) 57, 198
SatI GCNGC 1 cut(s) 48
Sau3AI GATC 2 cut(s) 60, 115
Sau96I GGNCC 2 cut(s) 34, 214
SetI ASST 4 cut(s) 45, 79, 95, 115
SfcI CTRYAG 1 cut(s) 88
SgeI CNNG 4 cut(s) 50, 52, 122, 188
Sse9I AATT 1 cut(s) 199
SspI AATATT 1 cut(s) 54
TasI AATT 1 cut(s) 199
Tru1I TTAA 2 cut(s) 57, 198
Tru9I TTAA 2 cut(s) 57, 198
TseI GCWGC 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 119
TspGWI ACGGA 1 cut(s) 138
XagI CCTNNNNNAGG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.