Rroxscaffold_7G00173110

Cystinosin homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
13262379 .. 13264016
1638 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00173110.1

Sequence Viewer

Length: 333 bp
ATGGATTTGGGAGTAGAAGCTGGAGTGGATGCCAAAGATTGCATCAAGATCAAGGATTCGAGAACGCGTGCTTCAACCCACGGAGTGGGAAGTTATGCACAAATGGCCGTGCAGTCTATTGATCAAGATTCTTGGGTGAACTTCTATGGAAACATAGGGAAGACACTGCTATCTTTGATATGTGTATCATTTGATCTTCTTTTCATTTGCCAACATTATGTGCTGTATCCTTCCAAGAAGGCATTGATATCTCCTAAAATGATCACCAACAAGGAGGACTTGGAGCCCCTTGTCGATTCGATAATCACCGGCCAAGTGTCCGAAAATGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.1

Weight (kDa)

5.17

Isoelectric Point (pI)

39.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019888)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 85
AccII CGCG 1 cut(s) 67
AcoI YGGCCR 2 cut(s) 105, 310
AdeI CACNNNGTG 1 cut(s) 85
AfiI CCNNNNNNNGG 1 cut(s) 85
AflIII ACRYGT 1 cut(s) 65
AgsI TTSAA 1 cut(s) 75
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
AoxI GGCC 2 cut(s) 105, 310
AsuHPI GGTGA 3 cut(s) 148, 256, 298
BanII GRGCYC 1 cut(s) 288
BbsI GAAGAC 1 cut(s) 167
BceAI ACGGC 1 cut(s) 92
BciVI GTATCC 1 cut(s) 237
BclI TGATCA 2 cut(s) 121, 261
BfaI CTAG 1 cut(s) 331
BfuI GTATCC 1 cut(s) 237
BmiI GGNNCC 1 cut(s) 285
BmsI GCATC 2 cut(s) 19, 51
BpiI GAAGAC 1 cut(s) 167
BpmI CTGGAG 1 cut(s) 42
BsaJI CCNNGG 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse118I RCCGGY 1 cut(s) 308
BseDI CCNNGG 1 cut(s) 79
BseGI GGATG 1 cut(s) 34
BseLI CCNNNNNNNGG 1 cut(s) 85
BsgI GTGCAG 1 cut(s) 131
Bsh1236I CGCG 1 cut(s) 67
BshFI GGCC 2 cut(s) 107, 312
BsiSI CCGG 1 cut(s) 309
BslI CCNNNNNNNGG 1 cut(s) 85
BsnI GGCC 2 cut(s) 107, 312
Bsp1286I GDGCHC 1 cut(s) 288
Bsp143I GATC 4 cut(s) 48, 121, 193, 261
BspANI GGCC 2 cut(s) 107, 312
BspFNI CGCG 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 285
BsrFI RCCGGY 1 cut(s) 308
BssAI RCCGGY 1 cut(s) 308
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 4 cut(s) 48, 121, 193, 261
BstC8I GCNNGC 1 cut(s) 69
BstDSI CCRYGG 1 cut(s) 79
BstF5I GGATG 1 cut(s) 34
BstFNI CGCG 1 cut(s) 67
BstKTI GATC 4 cut(s) 51, 124, 196, 264
BstMBI GATC 4 cut(s) 48, 121, 193, 261
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstUI CGCG 1 cut(s) 67
BstV2I GAAGAC 1 cut(s) 167
BsuI GTATCC 1 cut(s) 237
BsuRI GGCC 2 cut(s) 107, 312
BtgI CCRYGG 1 cut(s) 79
BtsCI GGATG 1 cut(s) 34
BtsI GCAGTG 1 cut(s) 164
BtsIMutI CAGTG 1 cut(s) 164
Cac8I GCNNGC 1 cut(s) 69
Cfr10I RCCGGY 1 cut(s) 308
CviJI RGCY 4 cut(s) 20, 107, 286, 312
CviKI_1 RGCY 4 cut(s) 20, 107, 286, 312
DpnI GATC 4 cut(s) 50, 123, 195, 263
DpnII GATC 4 cut(s) 48, 121, 193, 261
DraIII CACNNNGTG 1 cut(s) 85
EaeI YGGCCR 2 cut(s) 105, 310
Eco24I GRGCYC 1 cut(s) 288
Eco32I GATATC 1 cut(s) 249
EcoRV GATATC 1 cut(s) 249
EcoT38I GRGCYC 1 cut(s) 288
FaiI YATR 5 cut(s) 96, 147, 155, 181, 219
FalI AAGNNNNNCTT 2 cut(s) 263, 295
FbaI TGATCA 2 cut(s) 121, 261
FokI GGATG 1 cut(s) 41
FriOI GRGCYC 1 cut(s) 288
FspBI CTAG 1 cut(s) 331
GsuI CTGGAG 1 cut(s) 42
HaeIII GGCC 2 cut(s) 107, 312
HapII CCGG 1 cut(s) 309
HinfI GANTC 3 cut(s) 56, 128, 296
HpaII CCGG 1 cut(s) 309
HphI GGTGA 3 cut(s) 148, 256, 298
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 1 cut(s) 322
Hpy188III TCNNGA 3 cut(s) 46, 60, 125
Hpy8I GTNNAC 1 cut(s) 139
HpyAV CCTTC 2 cut(s) 232, 240
HpyCH4V TGCA 3 cut(s) 42, 98, 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
Ksp22I TGATCA 2 cut(s) 121, 261
Kzo9I GATC 4 cut(s) 48, 121, 193, 261
LmnI GCTCC 1 cut(s) 283
LpnPI CCDG 2 cut(s) 6, 322
LweI GCATC 2 cut(s) 19, 51
MaeI CTAG 1 cut(s) 331
MalI GATC 4 cut(s) 50, 123, 195, 263
MboI GATC 4 cut(s) 48, 121, 193, 261
MboII GAAGA 2 cut(s) 172, 188
MhlI GDGCHC 1 cut(s) 288
MluI ACGCGT 1 cut(s) 65
MnlI CCTC 1 cut(s) 268
MspI CCGG 1 cut(s) 309
MvnI CGCG 1 cut(s) 67
MwoI GCNNNNNNNGC 1 cut(s) 104
NdeII GATC 4 cut(s) 48, 121, 193, 261
NlaIV GGNNCC 1 cut(s) 285
PfeI GAWTC 3 cut(s) 56, 128, 296
PflMI CCANNNNNTGG 1 cut(s) 85
PspN4I GGNNCC 1 cut(s) 285
Sau3AI GATC 4 cut(s) 48, 121, 193, 261
SduI GDGCHC 1 cut(s) 288
SetI ASST 1 cut(s) 22
SfaNI GCATC 2 cut(s) 19, 51
SspMI CTAG 1 cut(s) 331
TaqI TCGA 3 cut(s) 59, 294, 299
TfiI GAWTC 3 cut(s) 56, 128, 296
TscAI CASTG 1 cut(s) 171
TspDTI ATGAA 1 cut(s) 193
TspGWI ACGGA 1 cut(s) 96
TspRI CASTG 1 cut(s) 171
Van91I CCANNNNNTGG 1 cut(s) 85
XspI CTAG 1 cut(s) 331
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.