Rh2BG663400

Cystinosin homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
87739548 .. 87740050
503 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG663400.1

Sequence Viewer

Length: 315 bp
ATGAACTTCATAAGAAAGAGCACAGATGGATTAAGTATTTTCTTTATTCTACTTGATCTTTCGGGAGGAGTGGGAAGTTATGCACAAATGGCTGTGCAGTCTATTGATCAAGATTCTTGGGTGAACTTTTATGGAAACATAGGGAAGACACTGCTATCTTTGATATGTGTATCATTTGATCTTCTTTTCATTTGCCAACATTATGTTCTGTATCCTTCCAAGAAGCCATTGATATCTCCTAAAATGATCACCAGCAAGGAGGACTTGGAGCCCCTTGTCAGTTCTAATAATCACCTAGTGTCTGAAAATGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.61

Weight (kDa)

5.47

Isoelectric Point (pI)

45.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PQ-loop PF04193 1 - 36 1.1e-07 PQ loop repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019888)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 298
AjuI GAANNNNNNNTTGG 2 cut(s) 189, 221
Alw21I GWGCWC 1 cut(s) 23
AsuHPI GGTGA 3 cut(s) 133, 241, 284
BanII GRGCYC 1 cut(s) 273
BbsI GAAGAC 1 cut(s) 152
Bbv12I GWGCWC 1 cut(s) 23
BccI CCATC 1 cut(s) 20
BciVI GTATCC 1 cut(s) 222
BclI TGATCA 2 cut(s) 106, 246
BfaI CTAG 2 cut(s) 296, 313
BfuI GTATCC 1 cut(s) 222
BmiI GGNNCC 1 cut(s) 270
BpiI GAAGAC 1 cut(s) 152
BseRI GAGGAG 1 cut(s) 81
BsgI GTGCAG 1 cut(s) 116
BsiHKAI GWGCWC 1 cut(s) 23
Bsp1286I GDGCHC 2 cut(s) 23, 273
Bsp143I GATC 4 cut(s) 55, 106, 178, 246
BspLI GGNNCC 1 cut(s) 270
BssMI GATC 4 cut(s) 55, 106, 178, 246
BstKTI GATC 4 cut(s) 58, 109, 181, 249
BstMBI GATC 4 cut(s) 55, 106, 178, 246
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstV2I GAAGAC 1 cut(s) 152
BsuI GTATCC 1 cut(s) 222
BtsI GCAGTG 1 cut(s) 149
BtsIMutI CAGTG 1 cut(s) 149
CviJI RGCY 3 cut(s) 92, 226, 271
CviKI_1 RGCY 3 cut(s) 92, 226, 271
DpnI GATC 4 cut(s) 57, 108, 180, 248
DpnII GATC 4 cut(s) 55, 106, 178, 246
DraIII CACNNNGTG 1 cut(s) 298
Eco24I GRGCYC 1 cut(s) 273
Eco32I GATATC 1 cut(s) 234
EcoRV GATATC 1 cut(s) 234
EcoT38I GRGCYC 1 cut(s) 273
FaiI YATR 6 cut(s) 11, 81, 132, 140, 166, 204
FalI AAGNNNNNCTT 2 cut(s) 248, 280
FbaI TGATCA 2 cut(s) 106, 246
FriOI GRGCYC 1 cut(s) 273
FspBI CTAG 2 cut(s) 296, 313
HinfI GANTC 1 cut(s) 113
HphI GGTGA 3 cut(s) 133, 241, 284
Hpy166II GTNNAC 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 304
Hpy188III TCNNGA 2 cut(s) 63, 110
Hpy8I GTNNAC 1 cut(s) 124
HpyAV CCTTC 1 cut(s) 225
HpyCH4V TGCA 2 cut(s) 83, 97
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
Ksp22I TGATCA 2 cut(s) 106, 246
Kzo9I GATC 4 cut(s) 55, 106, 178, 246
LmnI GCTCC 1 cut(s) 268
LpnPI CCDG 1 cut(s) 265
MaeI CTAG 2 cut(s) 296, 313
MalI GATC 4 cut(s) 57, 108, 180, 248
MboI GATC 4 cut(s) 55, 106, 178, 246
MboII GAAGA 2 cut(s) 157, 173
MhlI GDGCHC 2 cut(s) 23, 273
MnlI CCTC 2 cut(s) 59, 253
MseI TTAA 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 89
NdeII GATC 4 cut(s) 55, 106, 178, 246
NlaIV GGNNCC 1 cut(s) 270
PfeI GAWTC 1 cut(s) 113
PspN4I GGNNCC 1 cut(s) 270
SaqAI TTAA 1 cut(s) 32
Sau3AI GATC 4 cut(s) 55, 106, 178, 246
SduI GDGCHC 2 cut(s) 23, 273
SetI ASST 1 cut(s) 297
SspMI CTAG 2 cut(s) 296, 313
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TscAI CASTG 1 cut(s) 156
TspDTI ATGAA 2 cut(s) 17, 178
TspRI CASTG 1 cut(s) 156
XspI CTAG 2 cut(s) 296, 313
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.