Rroxscaffold_7G00201730

Purple acid phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0020359
Physical Location & Seq
Reverse (-)
49468707 .. 49469518
812 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00201730.1

Sequence Viewer

Length: 399 bp
ATGAGAGTGATGTTTGAGCCGTGGTTTGTACAGTACAAAGTTGACGTGGTATTTTCTAGTCATGACCATGCCTATGAACGATCTGAACGCATATTCAATGTAGCATATAACATTACAAATGGTAATTGCATTCCTGTGAAAGATCAATCTGCACTTGTGTACATTACCATTGGGGATGGAGGAAATCTTGAAGGCTTAGCAACCTTCATGACAGAGCCACAGCCAGAGTACTCGGCCTATCGAGAGGACAGTTTTGGTCATGCCATTTTTGACATCAAGAACCGAAGCCATGCTTATTTTAGTTGGCACCGTAATCAAGATGGATATGCTATAGAAGCTGATTCTATGATTTTCTTGAATAGATGCTTTCATCCTCTTGATGATTCTACAAGTGCTTGA

Protein Analysis

132

Amino Acids

15.24

Weight (kDa)

5.03

Isoelectric Point (pI)

41.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Metallophos_C PF14008 51 - 108 5.2e-19 Iron/zinc purple acid phosphatase-like protein C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020359)

Species Orthologous Gene IDs
malus_domestica MD06G1221700.v1.1 MD15G1020400.v1.1
rosa_chinensis RchiOBHm_Chr6g0266601
rosa_laevigata RLG00000014101
rosa_multiflora Rmu_sc0002769.1_g000001
rosa_roxburghii Rroxscaffold_7G00201730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 306
AfaI GTAC 4 cut(s) 30, 35, 161, 230
AgsI TTSAA 3 cut(s) 97, 191, 358
AjiI CACGTC 1 cut(s) 46
AluBI AGCT 1 cut(s) 338
AluI AGCT 1 cut(s) 338
AoxI GGCC 1 cut(s) 234
BanI GGYRCC 1 cut(s) 306
BccI CCATC 2 cut(s) 170, 314
BceAI ACGGC 1 cut(s) 4
BfaI CTAG 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 330
BlpI GCTNAGC 1 cut(s) 196
BmcAI AGTACT 1 cut(s) 230
BmgBI CACGTC 1 cut(s) 46
BmiI GGNNCC 1 cut(s) 308
BmsI GCATC 1 cut(s) 353
Bpu1102I GCTNAGC 1 cut(s) 196
BsaJI CCNNGG 1 cut(s) 20
BseDI CCNNGG 1 cut(s) 20
BseGI GGATG 2 cut(s) 181, 370
BsgI GTGCAG 1 cut(s) 135
BshFI GGCC 1 cut(s) 236
BshNI GGYRCC 1 cut(s) 306
BsmI GAATGC 1 cut(s) 129
BsnI GGCC 1 cut(s) 236
Bsp1407I TGTACA 2 cut(s) 28, 159
Bsp143I GATC 2 cut(s) 80, 142
Bsp1720I GCTNAGC 1 cut(s) 196
BspANI GGCC 1 cut(s) 236
BspHI TCATGA 2 cut(s) 61, 207
BspLI GGNNCC 1 cut(s) 308
BspT107I GGYRCC 1 cut(s) 306
BsrGI TGTACA 2 cut(s) 28, 159
BssECI CCNNGG 1 cut(s) 20
BssMI GATC 2 cut(s) 80, 142
Bst4CI ACNGT 3 cut(s) 33, 251, 311
BstAUI TGTACA 2 cut(s) 28, 159
BstDEI CTNAG 1 cut(s) 196
BstDSI CCRYGG 1 cut(s) 20
BstF5I GGATG 2 cut(s) 181, 370
BstKTI GATC 2 cut(s) 83, 145
BstMBI GATC 2 cut(s) 80, 142
BstMWI GCNNNNNNNGC 1 cut(s) 335
BstSFI CTRYAG 1 cut(s) 330
BsuRI GGCC 1 cut(s) 236
BtgI CCRYGG 1 cut(s) 20
BtrI CACGTC 1 cut(s) 46
BtsCI GGATG 2 cut(s) 181, 370
CciI TCATGA 2 cut(s) 61, 207
Csp6I GTAC 4 cut(s) 29, 34, 160, 229
CviAII CATG 5 cut(s) 62, 68, 208, 260, 290
CviJI RGCY 7 cut(s) 19, 195, 217, 223, 236, 288, 338
CviKI_1 RGCY 7 cut(s) 19, 195, 217, 223, 236, 288, 338
CviQI GTAC 4 cut(s) 29, 34, 160, 229
DdeI CTNAG 1 cut(s) 196
DpnI GATC 2 cut(s) 82, 144
DpnII GATC 2 cut(s) 80, 142
FaeI CATG 5 cut(s) 65, 71, 211, 263, 293
FalI AAGNNNNNCTT 2 cut(s) 277, 309
FatI CATG 5 cut(s) 61, 67, 207, 259, 289
FokI GGATG 2 cut(s) 188, 357
FspBI CTAG 1 cut(s) 57
HaeIII GGCC 1 cut(s) 236
Hin1II CATG 5 cut(s) 65, 71, 211, 263, 293
HincII GTYRAC 1 cut(s) 43
HindII GTYRAC 1 cut(s) 43
HinfI GANTC 2 cut(s) 341, 383
Hpy166II GTNNAC 2 cut(s) 43, 160
Hpy188I TCNGA 1 cut(s) 85
Hpy188III TCNNGA 8 cut(s) 62, 188, 208, 242, 277, 317, 355, 377
Hpy8I GTNNAC 2 cut(s) 43, 160
HpyAV CCTTC 2 cut(s) 185, 214
HpyCH4III ACNGT 3 cut(s) 33, 251, 311
HpyCH4IV ACGT 1 cut(s) 45
HpyCH4V TGCA 2 cut(s) 129, 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 335
HpyF3I CTNAG 1 cut(s) 196
HpySE526I ACGT 1 cut(s) 45
Hsp92II CATG 5 cut(s) 65, 71, 211, 263, 293
Kzo9I GATC 2 cut(s) 80, 142
LpnPI CCDG 2 cut(s) 147, 237
LweI GCATC 1 cut(s) 353
MaeI CTAG 1 cut(s) 57
MaeII ACGT 1 cut(s) 45
MalI GATC 2 cut(s) 82, 144
MboI GATC 2 cut(s) 80, 142
MluCI AATT 1 cut(s) 124
MnlI CCTC 3 cut(s) 173, 238, 384
MslI CAYNNNNRTG 3 cut(s) 66, 72, 134
Mva1269I GAATGC 1 cut(s) 129
MwoI GCNNNNNNNGC 1 cut(s) 335
NdeII GATC 2 cut(s) 80, 142
NlaIII CATG 5 cut(s) 65, 71, 211, 263, 293
NlaIV GGNNCC 1 cut(s) 308
NmeAIII GCCGAG 1 cut(s) 212
PagI TCATGA 2 cut(s) 61, 207
PctI GAATGC 1 cut(s) 129
PfeI GAWTC 2 cut(s) 341, 383
PspN4I GGNNCC 1 cut(s) 308
RsaI GTAC 4 cut(s) 30, 35, 161, 230
RsaNI GTAC 4 cut(s) 29, 34, 160, 229
RseI CAYNNNNRTG 3 cut(s) 66, 72, 134
Sau3AI GATC 2 cut(s) 80, 142
ScaI AGTACT 1 cut(s) 230
SetI ASST 3 cut(s) 48, 206, 340
SfaNI GCATC 1 cut(s) 353
SfcI CTRYAG 1 cut(s) 330
SmiMI CAYNNNNRTG 3 cut(s) 66, 72, 134
Sse9I AATT 1 cut(s) 124
SspMI CTAG 1 cut(s) 57
TaaI ACNGT 3 cut(s) 33, 251, 311
TaiI ACGT 1 cut(s) 48
TaqI TCGA 1 cut(s) 241
TasI AATT 1 cut(s) 124
TatI WGTACW 4 cut(s) 28, 33, 159, 228
TfiI GAWTC 2 cut(s) 341, 383
TspDTI ATGAA 3 cut(s) 90, 196, 359
XspI CTAG 1 cut(s) 57
ZrmI AGTACT 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.