Rorug01G0394700

DUF761-associated sequence motif

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
50481151 .. 50482394
1244 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0394700.1

Sequence Viewer

Length: 258 bp
ATGTCTTGGATGGTATTAATCCACATAGCTGTGATGCTCATTGATGAAATTGGTCAAGCTATCAAGTCATCTGGTGACAACAAATTGATCATATTCTTGGCCCCAACTGTTCATCTTGTTCGTCAGCAATTTGAGGTTATTAAAGAACACACTACTTTTAAAGAGGAGTATTATGGAGCCAAGGGGGTTGTTGCGTGGGATAAGGAGCATTGGGAAAAGGAATTTAAAACCCGTGATCATAGTGAGAACCACATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.99

Weight (kDa)

6.03

Isoelectric Point (pI)

38.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 221
AluBI AGCT 2 cut(s) 29, 59
AluI AGCT 2 cut(s) 29, 59
AoxI GGCC 1 cut(s) 99
ApoI RAATTY 1 cut(s) 221
AseI ATTAAT 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 100
AsuHPI GGTGA 1 cut(s) 86
BccI CCATC 1 cut(s) 4
BclI TGATCA 2 cut(s) 87, 235
BmgT120I GGNCC 1 cut(s) 100
BmiI GGNNCC 2 cut(s) 102, 178
BmsI GCATC 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 180
BseDI CCNNGG 1 cut(s) 180
BseGI GGATG 1 cut(s) 15
BseRI GAGGAG 1 cut(s) 179
BshFI GGCC 1 cut(s) 101
BsnI GGCC 1 cut(s) 101
Bsp143I GATC 2 cut(s) 87, 235
BspANI GGCC 1 cut(s) 101
BspLI GGNNCC 2 cut(s) 102, 178
BssECI CCNNGG 1 cut(s) 180
BssMI GATC 2 cut(s) 87, 235
BssT1I CCWWGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 109
BstF5I GGATG 1 cut(s) 15
BstKTI GATC 2 cut(s) 90, 238
BstMBI GATC 2 cut(s) 87, 235
BsuRI GGCC 1 cut(s) 101
BtsCI GGATG 1 cut(s) 15
Cfr13I GGNCC 1 cut(s) 100
CviJI RGCY 4 cut(s) 29, 59, 101, 179
CviKI_1 RGCY 4 cut(s) 29, 59, 101, 179
DpnI GATC 2 cut(s) 89, 237
DpnII GATC 2 cut(s) 87, 235
DraI TTTAAA 2 cut(s) 160, 226
Eco130I CCWWGG 1 cut(s) 180
EcoT14I CCWWGG 1 cut(s) 180
ErhI CCWWGG 1 cut(s) 180
FaiI YATR 4 cut(s) 26, 92, 174, 240
FbaI TGATCA 2 cut(s) 87, 235
FokI GGATG 1 cut(s) 22
HaeIII GGCC 1 cut(s) 101
HphI GGTGA 1 cut(s) 86
HpyCH4III ACNGT 1 cut(s) 109
Ksp22I TGATCA 2 cut(s) 87, 235
Kzo9I GATC 2 cut(s) 87, 235
LmnI GCTCC 2 cut(s) 176, 205
LpnPI CCDG 1 cut(s) 57
LweI GCATC 1 cut(s) 24
MaeIII GTNAC 1 cut(s) 74
MalI GATC 2 cut(s) 89, 237
MboI GATC 2 cut(s) 87, 235
MluCI AATT 4 cut(s) 48, 83, 128, 221
MnlI CCTC 2 cut(s) 127, 157
MseI TTAA 4 cut(s) 17, 141, 159, 225
MslI CAYNNNNRTG 1 cut(s) 29
NdeII GATC 2 cut(s) 87, 235
NlaIV GGNNCC 2 cut(s) 102, 178
NmuCI GTSAC 1 cut(s) 74
PshBI ATTAAT 1 cut(s) 17
PspN4I GGNNCC 2 cut(s) 102, 178
PspPI GGNCC 1 cut(s) 100
RseI CAYNNNNRTG 1 cut(s) 29
SaqAI TTAA 4 cut(s) 17, 141, 159, 225
Sau3AI GATC 2 cut(s) 87, 235
Sau96I GGNCC 1 cut(s) 100
SetI ASST 3 cut(s) 31, 61, 138
SfaNI GCATC 1 cut(s) 24
SmiMI CAYNNNNRTG 1 cut(s) 29
Sse9I AATT 4 cut(s) 48, 83, 128, 221
StyI CCWWGG 1 cut(s) 180
TaaI ACNGT 1 cut(s) 109
TasI AATT 4 cut(s) 48, 83, 128, 221
Tru1I TTAA 4 cut(s) 17, 141, 159, 225
Tru9I TTAA 4 cut(s) 17, 141, 159, 225
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspDTI ATGAA 2 cut(s) 60, 101
VspI ATTAAT 1 cut(s) 17
XapI RAATTY 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.