Rorug02G0044400

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
3498728 .. 3499039
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0044400.1

Sequence Viewer

Length: 312 bp
ATGCAGTTGGACTTCCGAACATACGTCGAAACAACAGTAAGCAAAGCAACAAAACTCCCTCATCATAGCCTCAAGGTTGCAGAAATTATTGGTTATCGTGGCCGTCAATGTGCTGTTGAACATGTCGTGTACTTGATAGAGAATGCTGTTGGACTAGAGAAAATTATTATTGATCCTGTTCGGCGTTGGATTTGGCCCCTCGGAATGGACAGGGGAACTAAAGTGTTGGATGAGGAAGTGAAGGCAAGAAAGCATGCTAAGAAACACCTTAAAGAAAGAGTTCCTTCTACTACTGAATTTGTATGCTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.92

Weight (kDa)

9.39

Isoelectric Point (pI)

28.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_At1g61320_AtMIF1 PF23622 14 - 100 4.4e-06 At1g61320/AtMIF1, LRR domain
FBD PF08387 21 - 57 2.1e-06 FBD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013016)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 167
AcoI YGGCCR 1 cut(s) 100
AcsI RAATTY 1 cut(s) 296
AfaI GTAC 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 205
AflIII ACRYGT 1 cut(s) 121
AgsI TTSAA 1 cut(s) 119
AlwI GGATC 1 cut(s) 167
AoxI GGCC 2 cut(s) 100, 194
ApoI RAATTY 1 cut(s) 296
Asp700I GAANNNNTTC 1 cut(s) 279
AspS9I GGNCC 1 cut(s) 195
BceAI ACGGC 1 cut(s) 87
BfaI CTAG 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 195
BmiI GGNNCC 1 cut(s) 197
BpuEI CTTGAG 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 199
Bsc4I CCNNNNNNNGG 1 cut(s) 205
BseDI CCNNGG 1 cut(s) 199
BseGI GGATG 1 cut(s) 235
BseLI CCNNNNNNNGG 1 cut(s) 205
BshFI GGCC 2 cut(s) 102, 196
BslI CCNNNNNNNGG 1 cut(s) 205
BsmI GAATGC 1 cut(s) 148
BsnI GGCC 2 cut(s) 102, 196
Bsp143I GATC 1 cut(s) 172
BspANI GGCC 2 cut(s) 102, 196
BspLI GGNNCC 1 cut(s) 197
BspPI GGATC 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 199
BssMI GATC 1 cut(s) 172
Bst4CI ACNGT 1 cut(s) 37
BstC8I GCNNGC 1 cut(s) 255
BstDEI CTNAG 1 cut(s) 258
BstF5I GGATG 1 cut(s) 235
BstKTI GATC 1 cut(s) 175
BstMBI GATC 1 cut(s) 172
BstNSI RCATGY 2 cut(s) 125, 257
BsuRI GGCC 2 cut(s) 102, 196
BtsCI GGATG 1 cut(s) 235
Cac8I GCNNGC 1 cut(s) 255
Cfr13I GGNCC 1 cut(s) 195
Csp6I GTAC 1 cut(s) 130
CviAII CATG 2 cut(s) 122, 254
CviJI RGCY 3 cut(s) 69, 102, 196
CviKI_1 RGCY 3 cut(s) 69, 102, 196
CviQI GTAC 1 cut(s) 130
DdeI CTNAG 1 cut(s) 258
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
EaeI YGGCCR 1 cut(s) 100
FaeI CATG 2 cut(s) 125, 257
FaiI YATR 6 cut(s) 22, 66, 123, 255, 304, 310
FalI AAGNNNNNCTT 2 cut(s) 268, 300
FatI CATG 2 cut(s) 121, 253
FokI GGATG 1 cut(s) 242
FspBI CTAG 1 cut(s) 155
HaeIII GGCC 2 cut(s) 102, 196
Hin1II CATG 2 cut(s) 125, 257
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 2 cut(s) 17, 203
Hpy8I GTNNAC 1 cut(s) 130
Hpy99I CGWCG 1 cut(s) 29
HpyAV CCTTC 2 cut(s) 235, 294
HpyCH4III ACNGT 1 cut(s) 37
HpyCH4IV ACGT 1 cut(s) 24
HpyCH4V TGCA 2 cut(s) 4, 80
HpyF3I CTNAG 1 cut(s) 258
HpySE526I ACGT 1 cut(s) 24
Hsp92II CATG 2 cut(s) 125, 257
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 2 cut(s) 189, 196
MaeI CTAG 1 cut(s) 155
MaeII ACGT 1 cut(s) 24
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MluCI AATT 3 cut(s) 84, 162, 296
MmeI TCCRAC 3 cut(s) 130, 167, 207
MnlI CCTC 4 cut(s) 69, 80, 209, 226
MroXI GAANNNNTTC 1 cut(s) 279
MseI TTAA 1 cut(s) 270
Mva1269I GAATGC 1 cut(s) 148
NdeII GATC 1 cut(s) 172
NlaIII CATG 2 cut(s) 125, 257
NlaIV GGNNCC 1 cut(s) 197
NspI RCATGY 2 cut(s) 125, 257
PaeI GCATGC 1 cut(s) 257
PciI ACATGT 1 cut(s) 121
PctI GAATGC 1 cut(s) 148
PdmI GAANNNNTTC 1 cut(s) 279
PscI ACATGT 1 cut(s) 121
PspN4I GGNNCC 1 cut(s) 197
PspPI GGNCC 1 cut(s) 195
RsaI GTAC 1 cut(s) 131
RsaNI GTAC 1 cut(s) 130
SaqAI TTAA 1 cut(s) 270
Sau3AI GATC 1 cut(s) 172
Sau96I GGNCC 1 cut(s) 195
SetI ASST 3 cut(s) 27, 78, 270
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
SphI GCATGC 1 cut(s) 257
Sse9I AATT 3 cut(s) 84, 162, 296
SspMI CTAG 1 cut(s) 155
TaaI ACNGT 1 cut(s) 37
TaiI ACGT 1 cut(s) 27
TaqI TCGA 1 cut(s) 27
TasI AATT 3 cut(s) 84, 162, 296
TatI WGTACW 1 cut(s) 129
Tru1I TTAA 1 cut(s) 270
Tru9I TTAA 1 cut(s) 270
XapI RAATTY 1 cut(s) 296
XceI RCATGY 2 cut(s) 125, 257
XmnI GAANNNNTTC 1 cut(s) 279
XspI CTAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.