Rorug02G0255900

Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes. The condensin complex probably introduces positive supercoils into relaxed DNA in the presence of type I topoisomerases and converts nicked DNA into positive knotted forms in the presence of type II topoisomerases

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0007785
Physical Location & Seq
Forward (+)
26773097 .. 26773366
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0255900.1

Sequence Viewer

Length: 270 bp
ATGGAGGCTGAAGCCCTAAGAGCGAGTTTATTAGTGGCTATTCATCAAGGTTGGGCAGAACTTGAGATAGAATCAGATTGTGTTGCGCTGCTTGATGCCATCTCTAAGGAGGAGGATGACTACTCTTTCATAGGTCGGATTGTTGACGATTGCAAAAGGTATAGTAGTGACTTTTCTTTCATTCAATTCCGACATGTGCACTGTGAAGCAAATGGTGTTGCACATTGTTTGGCACACCTTGCTAGTTTTAATTATGTTGATAATTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko04111 map04111
Pfam Domains
Protein Families
Cnd1 Cnd1_N Cohesin_HEAT

Protein Analysis

89

Amino Acids

10.07

Weight (kDa)

4.59

Isoelectric Point (pI)

25.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 80 3.3e-13 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 30
AflIII ACRYGT 1 cut(s) 193
AgsI TTSAA 1 cut(s) 185
Alw21I GWGCWC 1 cut(s) 201
Alw44I GTGCAC 1 cut(s) 197
ApaLI GTGCAC 1 cut(s) 197
ApeKI GCWGC 1 cut(s) 88
AspLEI GCGC 1 cut(s) 88
BaeGI GKGCMC 1 cut(s) 201
Bbv12I GWGCWC 1 cut(s) 201
BbvI GCAGC 1 cut(s) 75
BccI CCATC 1 cut(s) 107
BfaI CTAG 1 cut(s) 243
BisI GCNGC 1 cut(s) 89
BlsI GCNGC 1 cut(s) 90
BmsI GCATC 1 cut(s) 85
BpuEI CTTGAG 1 cut(s) 83
BseGI GGATG 1 cut(s) 121
BseRI GAGGAG 1 cut(s) 125
BseSI GKGCMC 1 cut(s) 201
BseXI GCAGC 1 cut(s) 75
BsiHKAI GWGCWC 1 cut(s) 201
Bsp1286I GDGCHC 1 cut(s) 201
Bst4CI ACNGT 1 cut(s) 203
BstAPI GCANNNNNTGC 1 cut(s) 239
BstDEI CTNAG 2 cut(s) 17, 105
BstF5I GGATG 1 cut(s) 121
BstHHI GCGC 1 cut(s) 88
BstMWI GCNNNNNNNGC 2 cut(s) 20, 239
BstNSI RCATGY 1 cut(s) 197
BstSLI GKGCMC 1 cut(s) 201
BstV1I GCAGC 1 cut(s) 75
BtsCI GGATG 1 cut(s) 121
BtsIMutI CAGTG 1 cut(s) 199
CfoI GCGC 1 cut(s) 88
CviAII CATG 1 cut(s) 194
CviJI RGCY 3 cut(s) 8, 14, 38
CviKI_1 RGCY 3 cut(s) 8, 14, 38
DdeI CTNAG 2 cut(s) 17, 105
Eco57I CTGAAG 1 cut(s) 30
FaeI CATG 1 cut(s) 197
FaiI YATR 4 cut(s) 131, 162, 195, 255
FatI CATG 1 cut(s) 193
Fnu4HI GCNGC 1 cut(s) 89
FokI GGATG 1 cut(s) 128
Fsp4HI GCNGC 1 cut(s) 89
FspBI CTAG 1 cut(s) 243
GlaI GCGC 1 cut(s) 87
GluI GCNGC 1 cut(s) 89
HhaI GCGC 1 cut(s) 88
Hin1II CATG 1 cut(s) 197
Hin6I GCGC 1 cut(s) 86
HinP1I GCGC 1 cut(s) 86
HincII GTYRAC 1 cut(s) 145
HindII GTYRAC 1 cut(s) 145
HinfI GANTC 1 cut(s) 71
Hpy166II GTNNAC 2 cut(s) 145, 199
Hpy188I TCNGA 4 cut(s) 76, 138, 191, 269
Hpy8I GTNNAC 2 cut(s) 145, 199
HpyCH4III ACNGT 1 cut(s) 203
HpyCH4V TGCA 3 cut(s) 153, 199, 221
HpyF10VI GCNNNNNNNGC 2 cut(s) 20, 239
HpyF3I CTNAG 2 cut(s) 17, 105
Hsp92II CATG 1 cut(s) 197
HspAI GCGC 1 cut(s) 86
Lsp1109I GCAGC 1 cut(s) 75
LweI GCATC 1 cut(s) 85
MaeI CTAG 1 cut(s) 243
MaeIII GTNAC 1 cut(s) 167
MhlI GDGCHC 1 cut(s) 201
MluCI AATT 3 cut(s) 185, 250, 262
MmeI TCCRAC 2 cut(s) 116, 214
MnlI CCTC 2 cut(s) 103, 106
MseI TTAA 1 cut(s) 249
MwoI GCNNNNNNNGC 2 cut(s) 20, 239
NlaIII CATG 1 cut(s) 197
NmuCI GTSAC 1 cut(s) 167
NspI RCATGY 1 cut(s) 197
PciI ACATGT 1 cut(s) 193
PfeI GAWTC 1 cut(s) 71
PkrI GCNGC 1 cut(s) 90
PscI ACATGT 1 cut(s) 193
SaqAI TTAA 1 cut(s) 249
SatI GCNGC 1 cut(s) 89
SduI GDGCHC 1 cut(s) 201
SetI ASST 4 cut(s) 52, 136, 161, 240
SfaNI GCATC 1 cut(s) 85
SgeI CNNG 7 cut(s) 36, 59, 74, 104, 206, 251, 255
SmlI CTYRAG 1 cut(s) 62
SmoI CTYRAG 1 cut(s) 62
Sse9I AATT 3 cut(s) 185, 250, 262
SspMI CTAG 1 cut(s) 243
TaaI ACNGT 1 cut(s) 203
TasI AATT 3 cut(s) 185, 250, 262
TfiI GAWTC 1 cut(s) 71
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TscAI CASTG 1 cut(s) 206
TseFI GTSAC 1 cut(s) 167
TseI GCWGC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 167
TspDTI ATGAA 3 cut(s) 32, 118, 169
TspRI CASTG 1 cut(s) 206
VneI GTGCAC 1 cut(s) 197
XceI RCATGY 1 cut(s) 197
XspI CTAG 1 cut(s) 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.