Rorug02G0286200

Belongs to the ubiquitin-conjugating enzyme family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
31178212 .. 31178424
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0286200.1

Sequence Viewer

Length: 213 bp
ATGGGAGGGAAAGACTGTCCTCCAGATGATTGTACCTATAACACCATTATCCGAGGGTTGTTAAATAACAATGAGACATCATGGGCTATGGGAACTCAAGAAATCGTGGATTATGGTTTCTCTGCAAATGTATTAACTATGGAATTGATAGTTGGTTTATTGTCTAAGAATATTATAGATCCAGCTTTGTTGTCGTTGTTAAAAGATGTATGA

Protein Analysis

70

Amino Acids

7.62

Weight (kDa)

4.12

Isoelectric Point (pI)

18.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016532)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G16890 AT1G16890
fragaria_vesca FvH4_6g27280
malus_domestica MD17G1231200.v1.1
prunus_persica Prupe.3G121300_v2.0.a1
pyrus_communis pycom17g23440
rosa_chinensis RchiOBHm_Chr2g0129381
rosa_multiflora Rmu_sc0001171.1_g000011
rosa_roxburghii Rroxscaffold_2G00114660
rosa_rugosa Rorug02G0286200
rosa_samantha Rh2BG346500 Rh2CG325900 Rh2DG364300
rosa_wichuraiana Rw2G027990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 173
AfaI GTAC 1 cut(s) 34
AjuI GAANNNNNNNTTGG 2 cut(s) 135, 167
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
Alw26I GTCTC 1 cut(s) 68
AlwI GGATC 1 cut(s) 173
BcoDI GTCTC 1 cut(s) 68
BpmI CTGGAG 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 52
BseDI CCNNGG 1 cut(s) 52
BsmAI GTCTC 1 cut(s) 68
Bsp143I GATC 1 cut(s) 178
BspPI GGATC 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 1 cut(s) 178
Bst4CI ACNGT 1 cut(s) 17
BstDEI CTNAG 1 cut(s) 165
BstKTI GATC 1 cut(s) 181
BstMAI GTCTC 1 cut(s) 68
BstMBI GATC 1 cut(s) 178
BstX2I RGATCY 1 cut(s) 178
BstYI RGATCY 1 cut(s) 178
Csp6I GTAC 1 cut(s) 33
CviAII CATG 1 cut(s) 81
CviJI RGCY 2 cut(s) 86, 185
CviKI_1 RGCY 2 cut(s) 86, 185
CviQI GTAC 1 cut(s) 33
DdeI CTNAG 1 cut(s) 165
DpnI GATC 1 cut(s) 180
DpnII GATC 1 cut(s) 178
FaeI CATG 1 cut(s) 84
FaiI YATR 7 cut(s) 39, 82, 89, 114, 140, 176, 211
FatI CATG 1 cut(s) 80
GsuI CTGGAG 1 cut(s) 6
Hin1II CATG 1 cut(s) 84
Hpy188I TCNGA 1 cut(s) 53
Hpy188III TCNNGA 2 cut(s) 23, 98
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 165
Hsp92II CATG 1 cut(s) 84
Kzo9I GATC 1 cut(s) 178
LpnPI CCDG 2 cut(s) 36, 195
MalI GATC 1 cut(s) 180
MboI GATC 1 cut(s) 178
MflI RGATCY 1 cut(s) 178
MluCI AATT 1 cut(s) 143
MnlI CCTC 2 cut(s) 30, 47
MseI TTAA 3 cut(s) 62, 134, 200
NdeII GATC 1 cut(s) 178
NlaIII CATG 1 cut(s) 84
PsuI RGATCY 1 cut(s) 178
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
SaqAI TTAA 3 cut(s) 62, 134, 200
Sau3AI GATC 1 cut(s) 178
SetI ASST 2 cut(s) 38, 187
SgeI CNNG 6 cut(s) 35, 65, 93, 110, 118, 194
SmlI CTYRAG 1 cut(s) 96
SmoI CTYRAG 1 cut(s) 96
Sse9I AATT 1 cut(s) 143
SspI AATATT 1 cut(s) 172
TaaI ACNGT 1 cut(s) 17
TasI AATT 1 cut(s) 143
Tru1I TTAA 3 cut(s) 62, 134, 200
Tru9I TTAA 3 cut(s) 62, 134, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.