Rorug02G0335300

GTPase involved in protein precursor import into chloroplasts. Seems to recognize chloroplast-destined precursor proteins and regulate their presentation to the translocation channel through GTP hydrolysis

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
41719953 .. 41720159
207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0335300.1

Sequence Viewer

Length: 207 bp
ATGAAGAATCAATCAATCATATATGTTCATGTGCAACAGCAGAAGAAGGTGGCCTCGGGGGAGGCCCCCATAGAAAAGAAAGACGACCTACGACCTTCTGCTGCTGCTGCTGCTTCTTCTTCTGCACTTTGTGGTGGAGGTCCTTCTAGGACAGTGATCTTAATTGATCCAAGAACAAGAAGACAAATCAGAAGCAAAGTCAATTAA

Protein Analysis

68

Amino Acids

7.33

Weight (kDa)

10.37

Isoelectric Point (pI)

69.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011417)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 161
AdeI CACNNNGTG 1 cut(s) 131
AlwI GGATC 1 cut(s) 161
Ama87I CYCGRG 1 cut(s) 55
AoxI GGCC 2 cut(s) 51, 63
ApeKI GCWGC 4 cut(s) 101, 104, 107, 110
AspS9I GGNCC 2 cut(s) 64, 140
AvaI CYCGRG 1 cut(s) 55
AvaII GGWCC 1 cut(s) 140
BbsI GAAGAC 1 cut(s) 187
BbvI GCAGC 4 cut(s) 88, 91, 94, 97
BfaI CTAG 1 cut(s) 147
BisI GCNGC 4 cut(s) 102, 105, 108, 111
BlsI GCNGC 4 cut(s) 103, 106, 109, 112
Bme18I GGWCC 1 cut(s) 140
BmeT110I CYCGRG 1 cut(s) 55
BmgT120I GGNCC 2 cut(s) 64, 140
BmiI GGNNCC 1 cut(s) 66
BpiI GAAGAC 1 cut(s) 187
BsaJI CCNNGG 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 54
BseXI GCAGC 4 cut(s) 88, 91, 94, 97
BsgI GTGCAG 1 cut(s) 108
BshFI GGCC 2 cut(s) 53, 65
BsiHKCI CYCGRG 1 cut(s) 55
BsnI GGCC 2 cut(s) 53, 65
BsoBI CYCGRG 1 cut(s) 55
Bsp143I GATC 2 cut(s) 156, 166
BspANI GGCC 2 cut(s) 53, 65
BspLI GGNNCC 1 cut(s) 66
BspPI GGATC 1 cut(s) 161
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 2 cut(s) 156, 166
Bst4CI ACNGT 1 cut(s) 154
BstKTI GATC 2 cut(s) 159, 169
BstMBI GATC 2 cut(s) 156, 166
BstMWI GCNNNNNNNGC 2 cut(s) 107, 110
BstV1I GCAGC 4 cut(s) 88, 91, 94, 97
BstV2I GAAGAC 1 cut(s) 187
BsuRI GGCC 2 cut(s) 53, 65
BtsIMutI CAGTG 1 cut(s) 159
Cfr13I GGNCC 2 cut(s) 64, 140
CviAII CATG 1 cut(s) 29
CviJI RGCY 2 cut(s) 53, 65
CviKI_1 RGCY 2 cut(s) 53, 65
DpnI GATC 2 cut(s) 158, 168
DpnII GATC 2 cut(s) 156, 166
DraIII CACNNNGTG 1 cut(s) 131
Eco47I GGWCC 1 cut(s) 140
Eco88I CYCGRG 1 cut(s) 55
EcoO109I RGGNCCY 2 cut(s) 64, 140
FaeI CATG 1 cut(s) 32
FaiI YATR 5 cut(s) 20, 22, 24, 30, 71
FatI CATG 1 cut(s) 28
Fnu4HI GCNGC 4 cut(s) 102, 105, 108, 111
Fsp4HI GCNGC 4 cut(s) 102, 105, 108, 111
FspBI CTAG 1 cut(s) 147
GluI GCNGC 4 cut(s) 102, 105, 108, 111
HaeIII GGCC 2 cut(s) 53, 65
Hin1II CATG 1 cut(s) 32
HinfI GANTC 1 cut(s) 7
Hpy188I TCNGA 1 cut(s) 191
HpyAV CCTTC 3 cut(s) 40, 105, 153
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 34, 125
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 110
Hsp92II CATG 1 cut(s) 32
Kzo9I GATC 2 cut(s) 156, 166
Lsp1109I GCAGC 4 cut(s) 88, 91, 94, 97
MaeI CTAG 1 cut(s) 147
MalI GATC 2 cut(s) 158, 168
MboI GATC 2 cut(s) 156, 166
MboII GAAGA 5 cut(s) 16, 55, 108, 111, 192
MluCI AATT 2 cut(s) 162, 202
MnlI CCTC 3 cut(s) 55, 64, 131
MseI TTAA 2 cut(s) 161, 205
MwoI GCNNNNNNNGC 2 cut(s) 107, 110
NdeII GATC 2 cut(s) 156, 166
NlaIII CATG 1 cut(s) 32
NlaIV GGNNCC 1 cut(s) 66
PfeI GAWTC 1 cut(s) 7
PkrI GCNGC 4 cut(s) 103, 106, 109, 112
PpuMI RGGWCCY 1 cut(s) 140
Psp5II RGGWCCY 1 cut(s) 140
PspN4I GGNNCC 1 cut(s) 66
PspPI GGNCC 2 cut(s) 64, 140
PspPPI RGGWCCY 1 cut(s) 140
SaqAI TTAA 2 cut(s) 161, 205
SatI GCNGC 4 cut(s) 102, 105, 108, 111
Sau3AI GATC 2 cut(s) 156, 166
Sau96I GGNCC 2 cut(s) 64, 140
SetI ASST 4 cut(s) 51, 90, 97, 142
SgeI CNNG 6 cut(s) 41, 67, 69, 159, 183, 189
SinI GGWCC 1 cut(s) 140
Sse9I AATT 2 cut(s) 162, 202
SspMI CTAG 1 cut(s) 147
TaaI ACNGT 1 cut(s) 154
TasI AATT 2 cut(s) 162, 202
TfiI GAWTC 1 cut(s) 7
Tru1I TTAA 2 cut(s) 161, 205
Tru9I TTAA 2 cut(s) 161, 205
TscAI CASTG 1 cut(s) 159
TseI GCWGC 4 cut(s) 101, 104, 107, 110
TspDTI ATGAA 2 cut(s) 17, 17
TspRI CASTG 1 cut(s) 159
VpaK11BI GGWCC 1 cut(s) 140
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.