Rorug04G0144900

membrane-associated kinase regulator

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0016041
Physical Location & Seq
Reverse (-)
24057775 .. 24058470
696 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0144900.1

Sequence Viewer

Length: 234 bp
ATGAAATTCCAGAAGGTGAGTAGCCTCTTCATCGTCTTTGTCACAACAGTAGCCATCTTGAGTCATGCTCAGGTTCAAGCAATTAGACTGCTACCCGAGGACTTTGCCGGTGCTAATCATTTGGAGACATACTCCTCCCCATCATCGCTGGCCTACGAGAAGGCCAAATACACCATGGAATGTTGGCTTCAACGACTGGCTTCAGGACCAAGCCCCAAAGGACCTGGTCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.48

Weight (kDa)

8.89

Isoelectric Point (pI)

48.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016041)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G26230
fragaria_vesca FvH4_4g15080
malus_domestica MD13G1188500.v1.1 MD16G1188900.v1.1
prunus_persica Prupe.1G155600_v2.0.a1
pyrus_communis pycom13g16280
rosa_laevigata RLG00000007951
rosa_multiflora Rmu_co8515525.1_g000001
rosa_roxburghii Rroxscaffold_5G00360660
rosa_rugosa Rorug04G0144900
rosa_samantha Rh4AG207500 Rh4BG204600 Rh4CG218400 Rh4DG204500
rosa_wichuraiana Rw4G017540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 5
AcuI CTGAAG 1 cut(s) 186
AgsI TTSAA 2 cut(s) 77, 191
AjnI CCWGG 1 cut(s) 223
Alw26I GTCTC 1 cut(s) 119
Ama87I CYCGRG 1 cut(s) 95
AoxI GGCC 2 cut(s) 150, 162
ApoI RAATTY 1 cut(s) 5
AspS9I GGNCC 2 cut(s) 206, 221
AsuHPI GGTGA 1 cut(s) 28
AvaI CYCGRG 1 cut(s) 95
AvaII GGWCC 2 cut(s) 206, 221
BarI GAAGNNNNNNTAC 2 cut(s) 152, 184
BccI CCATC 2 cut(s) 62, 148
BcgI CGANNNNNNTGC 2 cut(s) 86, 120
BciT130I CCWGG 1 cut(s) 225
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 1 cut(s) 232
Bme1390I CCNGG 1 cut(s) 225
Bme18I GGWCC 2 cut(s) 206, 221
BmeT110I CYCGRG 1 cut(s) 95
BmgT120I GGNCC 2 cut(s) 206, 221
BmrFI CCNGG 1 cut(s) 225
BplI GAGNNNNNCTC 4 cut(s) 52, 84, 116, 148
Bpu10I CCTNAGC 1 cut(s) 69
BpuEI CTTGAG 1 cut(s) 79
BsaJI CCNNGG 2 cut(s) 96, 174
Bse118I RCCGGY 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 201
BseBI CCWGG 1 cut(s) 225
BseDI CCNNGG 2 cut(s) 96, 174
BseMII CTCAG 1 cut(s) 83
BseNI ACTGG 1 cut(s) 201
BseRI GAGGAG 1 cut(s) 124
BshFI GGCC 2 cut(s) 152, 164
BsiHKCI CYCGRG 1 cut(s) 95
BsiSI CCGG 1 cut(s) 108
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 2 cut(s) 152, 164
BsoBI CYCGRG 1 cut(s) 95
Bsp19I CCATGG 1 cut(s) 174
BspANI GGCC 2 cut(s) 152, 164
BspCNI CTCAG 1 cut(s) 82
BsrFI RCCGGY 1 cut(s) 107
BsrI ACTGG 1 cut(s) 201
BssAI RCCGGY 1 cut(s) 107
BssECI CCNNGG 2 cut(s) 96, 174
BssT1I CCWWGG 1 cut(s) 174
Bst2UI CCWGG 1 cut(s) 225
Bst4CI ACNGT 1 cut(s) 49
Bst6I CTCTTC 1 cut(s) 32
BstC8I GCNNGC 1 cut(s) 150
BstDEI CTNAG 1 cut(s) 69
BstDSI CCRYGG 1 cut(s) 174
BstMAI GTCTC 1 cut(s) 119
BstNI CCWGG 1 cut(s) 225
BstSCI CCNGG 1 cut(s) 223
BsuRI GGCC 2 cut(s) 152, 164
BtgI CCRYGG 1 cut(s) 174
BtgZI GCGATG 1 cut(s) 129
Cac8I GCNNGC 1 cut(s) 150
Cfr10I RCCGGY 1 cut(s) 107
Cfr13I GGNCC 2 cut(s) 206, 221
CsiI ACCWGGT 1 cut(s) 223
CviAII CATG 2 cut(s) 65, 175
CviJI RGCY 7 cut(s) 24, 53, 152, 164, 187, 200, 213
CviKI_1 RGCY 7 cut(s) 24, 53, 152, 164, 187, 200, 213
DdeI CTNAG 1 cut(s) 69
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
Eco130I CCWWGG 1 cut(s) 174
Eco47I GGWCC 2 cut(s) 206, 221
Eco57I CTGAAG 1 cut(s) 186
Eco88I CYCGRG 1 cut(s) 95
EcoO109I RGGNCCY 1 cut(s) 221
EcoRII CCWGG 1 cut(s) 223
EcoT14I CCWWGG 1 cut(s) 174
ErhI CCWWGG 1 cut(s) 174
FaeI CATG 2 cut(s) 68, 178
FaiI YATR 3 cut(s) 66, 130, 176
FatI CATG 2 cut(s) 64, 174
FspBI CTAG 1 cut(s) 232
HaeIII GGCC 2 cut(s) 152, 164
HapII CCGG 1 cut(s) 108
Hin1II CATG 2 cut(s) 68, 178
HinfI GANTC 1 cut(s) 61
HpaII CCGG 1 cut(s) 108
HphI GGTGA 1 cut(s) 28
Hpy188III TCNNGA 3 cut(s) 10, 58, 204
HpyAV CCTTC 2 cut(s) 7, 154
HpyCH4III ACNGT 1 cut(s) 49
HpyF3I CTNAG 1 cut(s) 69
Hsp92II CATG 2 cut(s) 68, 178
LpnPI CCDG 7 cut(s) 23, 56, 121, 134, 182, 189, 210
MabI ACCWGGT 1 cut(s) 223
MaeI CTAG 1 cut(s) 232
MaeIII GTNAC 2 cut(s) 40, 227
MboII GAAGA 1 cut(s) 19
MluCI AATT 2 cut(s) 5, 81
MlyI GAGTC 1 cut(s) 70
MnlI CCTC 3 cut(s) 35, 91, 145
MspI CCGG 1 cut(s) 108
MspR9I CCNGG 1 cut(s) 225
MvaI CCWGG 1 cut(s) 225
NcoI CCATGG 1 cut(s) 174
NlaIII CATG 2 cut(s) 68, 178
NmuCI GTSAC 2 cut(s) 40, 227
PflFI GACNNNGTC 1 cut(s) 225
PleI GAGTC 1 cut(s) 69
PpsI GAGTC 1 cut(s) 69
PpuMI RGGWCCY 1 cut(s) 221
Psp5II RGGWCCY 1 cut(s) 221
Psp6I CCWGG 1 cut(s) 223
PspGI CCWGG 1 cut(s) 223
PspPI GGNCC 2 cut(s) 206, 221
PspPPI RGGWCCY 1 cut(s) 221
PsyI GACNNNGTC 1 cut(s) 225
Sau96I GGNCC 2 cut(s) 206, 221
SchI GAGTC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 225
SetI ASST 3 cut(s) 18, 75, 226
SexAI ACCWGGT 1 cut(s) 223
SinI GGWCC 2 cut(s) 206, 221
SmlI CTYRAG 1 cut(s) 58
SmoI CTYRAG 1 cut(s) 58
Sse9I AATT 2 cut(s) 5, 81
SspMI CTAG 1 cut(s) 232
StyD4I CCNGG 1 cut(s) 223
StyI CCWWGG 1 cut(s) 174
TaaI ACNGT 1 cut(s) 49
TasI AATT 2 cut(s) 5, 81
TseFI GTSAC 2 cut(s) 40, 227
Tsp45I GTSAC 2 cut(s) 40, 227
TspDTI ATGAA 2 cut(s) 17, 19
Tth111I GACNNNGTC 1 cut(s) 225
VpaK11BI GGWCC 2 cut(s) 206, 221
XapI RAATTY 1 cut(s) 5
XcmI CCANNNNNNNNNTGG 1 cut(s) 172
XspI CTAG 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.