Rorug05G0327900

Cytochrome B561, N terminal

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0016195
Physical Location & Seq
Reverse (-)
39462280 .. 39462807
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0327900.1

Sequence Viewer

Length: 441 bp
ATGAGGCTTCGCAGCGGTGAACCTCGACAAGATTTTGAAGTTCGATATCATATCCAGTCAGCTACAAAGCTTCATCTTCCTAGAGTTAAATTCAAGTTGAGAGAGCTTAAGTTCATTGCATTTGAACGGTGCTTCTATCATTCCTCAATACCCATAACAACATATGCTGCATTCATGAGTTGCCTATTTCGCACGTCTAAGAGCAGAAAGCTTCTCTACCATAATAGTATTACCAAGAACTATTCAGCCTATGAGGATATTGCAAATACTATTACAAACATCGGCAAAGGTGTCGCTATTGATTTTGAACAGTTTTATCTACTGAATCTGTTCAAAGATGTGAGTACCAAAAAAATATTTGATACGTGCGATGGGCGGAGTTCAAGTTCAAGTATTTTGGTTCTCGCTGGTCTTTCTTGTCTGTTTTTGTTAAAACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CytochromB561_N

Protein Analysis

146

Amino Acids

16.91

Weight (kDa)

9.63

Isoelectric Point (pI)

54.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 38 - 115 9e-10 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016195)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G07970
fragaria_vesca FvH4_3g32920
prunus_persica Prupe.6G097500_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0060051
rosa_laevigata RLG00000035342
rosa_multiflora Rmu_sc0000493.1_g000021 Rmu_sc0000493.1_g000024 Rmu_sc0003366.1_g000027
rosa_roxburghii Rroxscaffold_1G00020590
rosa_rugosa Rorug05G0327900
rosa_samantha Rh5AG391700 Rh5BG404400 Rh5CG428000 Rh5DG419900
rosa_wichuraiana Rw5G036910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 15, 376
AcsI RAATTY 1 cut(s) 89
AfaI GTAC 1 cut(s) 346
AflII CTTAAG 1 cut(s) 107
AgsI TTSAA 7 cut(s) 38, 94, 125, 308, 334, 384, 390
AjiI CACGTC 1 cut(s) 195
AloI GAACNNNNNNTCC 2 cut(s) 370, 402
AluBI AGCT 4 cut(s) 62, 70, 106, 211
AluI AGCT 4 cut(s) 62, 70, 106, 211
ApeKI GCWGC 2 cut(s) 12, 167
ApoI RAATTY 1 cut(s) 89
Asp700I GAANNNNTTC 1 cut(s) 329
AsuHPI GGTGA 1 cut(s) 29
BbvI GCAGC 2 cut(s) 24, 154
BccI CCATC 1 cut(s) 365
BcgI CGANNNNNNTGC 2 cut(s) 274, 308
BfaI CTAG 1 cut(s) 81
BfrI CTTAAG 1 cut(s) 107
BisI GCNGC 2 cut(s) 13, 168
BlsI GCNGC 2 cut(s) 14, 169
BmgBI CACGTC 1 cut(s) 195
BsaAI YACGTR 1 cut(s) 366
BsaXI ACNNNNNCTCC 2 cut(s) 370, 400
Bse1I ACTGG 1 cut(s) 55
Bse3DI GCAATG 1 cut(s) 114
BseMI GCAATG 1 cut(s) 114
BseNI ACTGG 1 cut(s) 55
BseXI GCAGC 2 cut(s) 24, 154
BsmI GAATGC 1 cut(s) 170
BspACI CCGC 2 cut(s) 15, 376
BspHI TCATGA 1 cut(s) 174
BspTI CTTAAG 1 cut(s) 107
BsrDI GCAATG 1 cut(s) 114
BsrI ACTGG 1 cut(s) 55
Bst4CI ACNGT 3 cut(s) 129, 312, 438
BstAFI CTTAAG 1 cut(s) 107
BstBAI YACGTR 1 cut(s) 366
BstDEI CTNAG 1 cut(s) 198
BstMWI GCNNNNNNNGC 1 cut(s) 189
BstV1I GCAGC 2 cut(s) 24, 154
BtgZI GCGATG 1 cut(s) 384
BtrI CACGTC 1 cut(s) 195
CciI TCATGA 1 cut(s) 174
Csp6I GTAC 1 cut(s) 345
CviAII CATG 1 cut(s) 175
CviJI RGCY 6 cut(s) 7, 62, 70, 106, 211, 248
CviKI_1 RGCY 6 cut(s) 7, 62, 70, 106, 211, 248
CviQI GTAC 1 cut(s) 345
DdeI CTNAG 1 cut(s) 198
EciI GGCGGA 1 cut(s) 391
Eco32I GATATC 1 cut(s) 47
EcoRV GATATC 1 cut(s) 47
FaeI CATG 1 cut(s) 178
FaiI YATR 7 cut(s) 51, 155, 163, 165, 176, 222, 252
FatI CATG 1 cut(s) 174
FauNDI CATATG 1 cut(s) 163
Fnu4HI GCNGC 2 cut(s) 13, 168
Fsp4HI GCNGC 2 cut(s) 13, 168
FspBI CTAG 1 cut(s) 81
GluI GCNGC 2 cut(s) 13, 168
Hin1II CATG 1 cut(s) 178
HindIII AAGCTT 2 cut(s) 68, 209
HinfI GANTC 1 cut(s) 325
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 20
Hpy188III TCNNGA 1 cut(s) 175
Hpy8I GTNNAC 1 cut(s) 20
HpyCH4III ACNGT 3 cut(s) 129, 312, 438
HpyCH4IV ACGT 2 cut(s) 194, 365
HpyCH4V TGCA 3 cut(s) 119, 170, 263
HpyF10VI GCNNNNNNNGC 1 cut(s) 189
HpyF3I CTNAG 1 cut(s) 198
HpySE526I ACGT 2 cut(s) 194, 365
Hsp92II CATG 1 cut(s) 178
LpnPI CCDG 2 cut(s) 68, 393
Lsp1109I GCAGC 2 cut(s) 24, 154
MaeI CTAG 1 cut(s) 81
MaeII ACGT 2 cut(s) 194, 365
MboII GAAGA 1 cut(s) 68
MluCI AATT 1 cut(s) 89
MnlI CCTC 3 cut(s) 33, 154, 247
MroXI GAANNNNTTC 1 cut(s) 329
MseI TTAA 3 cut(s) 87, 108, 431
MspA1I CMGCKG 1 cut(s) 15
MspCI CTTAAG 1 cut(s) 107
Mva1269I GAATGC 1 cut(s) 170
MwoI GCNNNNNNNGC 1 cut(s) 189
NdeI CATATG 1 cut(s) 163
NlaIII CATG 1 cut(s) 178
PagI TCATGA 1 cut(s) 174
PctI GAATGC 1 cut(s) 170
PdmI GAANNNNTTC 1 cut(s) 329
PfeI GAWTC 1 cut(s) 325
PkrI GCNGC 2 cut(s) 14, 169
Ppu21I YACGTR 1 cut(s) 366
RsaI GTAC 1 cut(s) 346
RsaNI GTAC 1 cut(s) 345
SaqAI TTAA 3 cut(s) 87, 108, 431
SatI GCNGC 2 cut(s) 13, 168
SetI ASST 8 cut(s) 25, 64, 72, 108, 197, 213, 292, 368
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
Sse9I AATT 1 cut(s) 89
SsiI CCGC 2 cut(s) 15, 376
SspI AATATT 1 cut(s) 357
SspMI CTAG 1 cut(s) 81
TaaI ACNGT 3 cut(s) 129, 312, 438
TaiI ACGT 2 cut(s) 197, 368
TaqI TCGA 2 cut(s) 25, 43
TasI AATT 1 cut(s) 89
TfiI GAWTC 1 cut(s) 325
Tru1I TTAA 3 cut(s) 87, 108, 431
Tru9I TTAA 3 cut(s) 87, 108, 431
TseI GCWGC 2 cut(s) 12, 167
TspDTI ATGAA 3 cut(s) 62, 103, 163
Vha464I CTTAAG 1 cut(s) 107
XapI RAATTY 1 cut(s) 89
XmnI GAANNNNTTC 1 cut(s) 329
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.