Rh1AG436600

Belongs to the glycosyl hydrolase 18 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
66088870 .. 66089061
192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG436600.1

Sequence Viewer

Length: 192 bp
ATGGCTTCAATTTTAGTAGCAGCATTGCTATCTTTAGCAACACTACTACTTCTGGCAGTTGGGTCTAATGCAGGCGGAATCGCGATTTACTGGGGCCAAAATGGAAATGAAGGCACATTAGCACAAACATGTGCCTCAGGGAACTACAAGTTTGTAAACATAGCTTTCCTTTCATCATTTGGCAATGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

6.34

Weight (kDa)

5.75

Isoelectric Point (pI)

10.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020398)

Species Orthologous Gene IDs
malus_domestica MD07G1129800.v1.1
rosa_chinensis RchiOBHm_Chr2g0156261
rosa_multiflora Rmu_sc0002071.1_g000011 Rmu_sc0007072.1_g000003
rosa_samantha Rh1AG436600 Rh4AG100600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 83
AciI CCGC 1 cut(s) 75
AflIII ACRYGT 1 cut(s) 128
AgsI TTSAA 1 cut(s) 9
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
AoxI GGCC 1 cut(s) 94
ApeKI GCWGC 1 cut(s) 20
AspS9I GGNCC 1 cut(s) 94
AxyI CCTNAGG 1 cut(s) 136
BbvI GCAGC 1 cut(s) 32
BisI GCNGC 1 cut(s) 21
BlsI GCNGC 1 cut(s) 22
BmgT120I GGNCC 1 cut(s) 94
BmiI GGNNCC 1 cut(s) 95
BmrI ACTGGG 1 cut(s) 100
BmuI ACTGGG 1 cut(s) 100
Bse1I ACTGG 1 cut(s) 95
Bse21I CCTNAGG 1 cut(s) 136
Bse3DI GCAATG 2 cut(s) 23, 190
BseMI GCAATG 2 cut(s) 23, 190
BseMII CTCAG 1 cut(s) 150
BseNI ACTGG 1 cut(s) 95
BseXI GCAGC 1 cut(s) 32
Bsh1236I CGCG 1 cut(s) 83
BshFI GGCC 1 cut(s) 96
BsnI GGCC 1 cut(s) 96
Bsp68I TCGCGA 1 cut(s) 83
BspACI CCGC 1 cut(s) 75
BspANI GGCC 1 cut(s) 96
BspCNI CTCAG 1 cut(s) 149
BspFNI CGCG 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 95
BsrDI GCAATG 2 cut(s) 23, 190
BsrI ACTGG 1 cut(s) 95
BstC8I GCNNGC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 136
BstFNI CGCG 1 cut(s) 83
BstNSI RCATGY 1 cut(s) 132
BstUI CGCG 1 cut(s) 83
BstV1I GCAGC 1 cut(s) 32
Bsu36I CCTNAGG 1 cut(s) 136
BsuRI GGCC 1 cut(s) 96
BtuMI TCGCGA 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 94
CviAII CATG 1 cut(s) 129
CviJI RGCY 4 cut(s) 5, 96, 164, 189
CviKI_1 RGCY 4 cut(s) 5, 96, 164, 189
DdeI CTNAG 1 cut(s) 136
EciI GGCGGA 1 cut(s) 90
Eco81I CCTNAGG 1 cut(s) 136
FaeI CATG 1 cut(s) 132
FaiI YATR 2 cut(s) 130, 161
FatI CATG 1 cut(s) 128
Fnu4HI GCNGC 1 cut(s) 21
Fsp4HI GCNGC 1 cut(s) 21
GluI GCNGC 1 cut(s) 21
HaeIII GGCC 1 cut(s) 96
Hin1II CATG 1 cut(s) 132
HinfI GANTC 1 cut(s) 78
Hpy166II GTNNAC 1 cut(s) 157
Hpy188III TCNNGA 1 cut(s) 82
Hpy8I GTNNAC 1 cut(s) 157
HpyAV CCTTC 1 cut(s) 104
HpyCH4V TGCA 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 136
Hsp92II CATG 1 cut(s) 132
LpnPI CCDG 4 cut(s) 38, 57, 76, 123
Lsp1109I GCAGC 1 cut(s) 32
MluCI AATT 1 cut(s) 9
MnlI CCTC 1 cut(s) 145
MslI CAYNNNNRTG 1 cut(s) 127
MvnI CGCG 1 cut(s) 83
NlaIII CATG 1 cut(s) 132
NlaIV GGNNCC 1 cut(s) 95
NruI TCGCGA 1 cut(s) 83
NspI RCATGY 1 cut(s) 132
PciI ACATGT 1 cut(s) 128
PfeI GAWTC 1 cut(s) 78
PkrI GCNGC 1 cut(s) 22
PscI ACATGT 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 95
PspPI GGNCC 1 cut(s) 94
RruI TCGCGA 1 cut(s) 83
RseI CAYNNNNRTG 1 cut(s) 127
SatI GCNGC 1 cut(s) 21
Sau96I GGNCC 1 cut(s) 94
SetI ASST 1 cut(s) 166
SgeI CNNG 7 cut(s) 65, 84, 94, 103, 141, 150, 160
SmiMI CAYNNNNRTG 1 cut(s) 127
Sse9I AATT 1 cut(s) 9
SsiI CCGC 1 cut(s) 75
TasI AATT 1 cut(s) 9
TfiI GAWTC 1 cut(s) 78
TseI GCWGC 1 cut(s) 20
TspDTI ATGAA 2 cut(s) 123, 162
XceI RCATGY 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.