Rh1CG020800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
3471747 .. 3487113
15367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG020800.1

Sequence Viewer

Length: 159 bp
ATGAAGATTTTAGAGAGCTTCCAGGGACCCTTAATGCAGAACGTCTTGATGGGGACATACGAACTGGCTATTCATGGAGCAAGCCATGAGCGAGTGGCCAAATTACACGTTGAGGAGGAAGAAGCAATGGTTGGAGAACAACCACGACAACAAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.89

Weight (kDa)

5.14

Isoelectric Point (pI)

35.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019337)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0316721
rosa_laevigata RLG00000030649
rosa_roxburghii Rroxscaffold_4G00330850 Rroxscaffold_5G00374640
rosa_rugosa Rorug01G0012500
rosa_samantha Rh1CG020800 Rh1DG020000
rosa_wichuraiana Rw1G001520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 96
AflIII ACRYGT 1 cut(s) 106
AjnI CCWGG 1 cut(s) 21
AjuI GAANNNNNNNTTGG 2 cut(s) 114, 146
AluBI AGCT 1 cut(s) 18
AluI AGCT 1 cut(s) 18
AoxI GGCC 1 cut(s) 96
AspS9I GGNCC 1 cut(s) 26
AvaII GGWCC 1 cut(s) 26
BalI TGGCCA 1 cut(s) 98
BccI CCATC 1 cut(s) 43
BciT130I CCWGG 1 cut(s) 23
Bme1390I CCNGG 1 cut(s) 23
Bme18I GGWCC 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 26
BmiI GGNNCC 2 cut(s) 27, 28
BmrFI CCNGG 1 cut(s) 23
BsaJI CCNNGG 1 cut(s) 22
Bse1I ACTGG 1 cut(s) 69
Bse3DI GCAATG 1 cut(s) 132
BseBI CCWGG 1 cut(s) 23
BseDI CCNNGG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 132
BseNI ACTGG 1 cut(s) 69
BseRI GAGGAG 1 cut(s) 128
BshFI GGCC 1 cut(s) 98
BslFI GGGAC 2 cut(s) 39, 67
BsmFI GGGAC 2 cut(s) 39, 67
BsnI GGCC 1 cut(s) 98
BspANI GGCC 1 cut(s) 98
BspLI GGNNCC 2 cut(s) 27, 28
BsrDI GCAATG 1 cut(s) 132
BsrI ACTGG 1 cut(s) 69
BssECI CCNNGG 1 cut(s) 22
Bst2UI CCWGG 1 cut(s) 23
BstC8I GCNNGC 1 cut(s) 82
BstNI CCWGG 1 cut(s) 23
BstSCI CCNGG 1 cut(s) 21
BsuRI GGCC 1 cut(s) 98
Cac8I GCNNGC 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 26
CviAII CATG 2 cut(s) 74, 86
CviJI RGCY 4 cut(s) 18, 68, 84, 98
CviKI_1 RGCY 4 cut(s) 18, 68, 84, 98
EaeI YGGCCR 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 26
EcoO109I RGGNCCY 1 cut(s) 26
EcoRII CCWGG 1 cut(s) 21
FaeI CATG 2 cut(s) 77, 89
FaiI YATR 3 cut(s) 58, 75, 87
FaqI GGGAC 2 cut(s) 39, 67
FatI CATG 2 cut(s) 73, 85
HaeIII GGCC 1 cut(s) 98
Hin1II CATG 2 cut(s) 77, 89
Hpy188III TCNNGA 1 cut(s) 46
HpyCH4IV ACGT 2 cut(s) 42, 108
HpyCH4V TGCA 1 cut(s) 37
HpySE526I ACGT 2 cut(s) 42, 108
Hsp92II CATG 2 cut(s) 77, 89
KflI GGGWCCC 1 cut(s) 26
LmnI GCTCC 1 cut(s) 77
LpnPI CCDG 3 cut(s) 8, 35, 50
MaeII ACGT 2 cut(s) 42, 108
MboII GAAGA 2 cut(s) 16, 131
MlsI TGGCCA 1 cut(s) 98
MluCI AATT 1 cut(s) 101
MluNI TGGCCA 1 cut(s) 98
MmeI TCCRAC 1 cut(s) 112
MnlI CCTC 2 cut(s) 106, 109
Mox20I TGGCCA 1 cut(s) 98
MscI TGGCCA 1 cut(s) 98
MseI TTAA 1 cut(s) 32
Msp20I TGGCCA 1 cut(s) 98
MspR9I CCNGG 1 cut(s) 23
MvaI CCWGG 1 cut(s) 23
NlaIII CATG 2 cut(s) 77, 89
NlaIV GGNNCC 2 cut(s) 27, 28
PpuMI RGGWCCY 1 cut(s) 26
Psp5II RGGWCCY 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 21
PspGI CCWGG 1 cut(s) 21
PspN4I GGNNCC 2 cut(s) 27, 28
PspPI GGNCC 1 cut(s) 26
PspPPI RGGWCCY 1 cut(s) 26
SaqAI TTAA 1 cut(s) 32
Sau96I GGNCC 1 cut(s) 26
ScrFI CCNGG 1 cut(s) 23
SetI ASST 3 cut(s) 20, 45, 111
SgeI CNNG 9 cut(s) 34, 35, 58, 77, 86, 93, 98, 104, 119
SinI GGWCC 1 cut(s) 26
Sse9I AATT 1 cut(s) 101
StyD4I CCNGG 1 cut(s) 21
TaiI ACGT 2 cut(s) 45, 111
TasI AATT 1 cut(s) 101
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TspDTI ATGAA 2 cut(s) 17, 62
VpaK11BI GGWCC 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.