Rh1DG182900

Rgp1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
36978671 .. 36980862
2192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG182900.1

Sequence Viewer

Length: 195 bp
ATGGCGTATTCGCTGCTAATCGAGTGCCTGGGGTTTGAGATTAAAGGTATTGAGAAGCTGGATTCGCAGTGGTTCGCCACGCAGAAACCTGTGCCTGGATCCAAACAGAGAAGAGTGATGGCAGCAAGCTCTGGAAATGATGAACATGCCTGGGGTTTGCAAGTCCTAGAGGAGAAAGATGAGAAAGATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.24

Weight (kDa)

4.97

Isoelectric Point (pI)

65.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 93, 106
AfiI CCNNNNNNNGG 1 cut(s) 95
AjnI CCWGG 3 cut(s) 27, 94, 149
AluBI AGCT 2 cut(s) 58, 129
AluI AGCT 2 cut(s) 58, 129
AlwI GGATC 2 cut(s) 93, 106
ApeKI GCWGC 2 cut(s) 13, 122
BamHI GGATCC 1 cut(s) 98
BbvI GCAGC 1 cut(s) 134
BccI CCATC 1 cut(s) 112
BciT130I CCWGG 3 cut(s) 29, 96, 151
BfaI CTAG 1 cut(s) 167
BisI GCNGC 2 cut(s) 14, 123
BlsI GCNGC 2 cut(s) 15, 124
Bme1390I CCNGG 3 cut(s) 29, 96, 151
BmiI GGNNCC 1 cut(s) 100
BmrFI CCNGG 3 cut(s) 29, 96, 151
BsaJI CCNNGG 2 cut(s) 28, 150
Bsc4I CCNNNNNNNGG 1 cut(s) 95
BseBI CCWGG 3 cut(s) 29, 96, 151
BseDI CCNNGG 2 cut(s) 28, 150
BseLI CCNNNNNNNGG 1 cut(s) 95
BseRI GAGGAG 1 cut(s) 185
BseXI GCAGC 1 cut(s) 134
BslI CCNNNNNNNGG 1 cut(s) 95
Bsp143I GATC 1 cut(s) 98
BspLI GGNNCC 1 cut(s) 100
BspPI GGATC 2 cut(s) 93, 106
BssECI CCNNGG 2 cut(s) 28, 150
BssMI GATC 1 cut(s) 98
Bst2UI CCWGG 3 cut(s) 29, 96, 151
Bst6I CTCTTC 1 cut(s) 106
BstC8I GCNNGC 1 cut(s) 127
BstKTI GATC 1 cut(s) 101
BstMBI GATC 1 cut(s) 98
BstMWI GCNNNNNNNGC 1 cut(s) 64
BstNI CCWGG 3 cut(s) 29, 96, 151
BstNSI RCATGY 1 cut(s) 149
BstSCI CCNGG 3 cut(s) 27, 94, 149
BstV1I GCAGC 1 cut(s) 134
BstX2I RGATCY 1 cut(s) 98
BstYI RGATCY 1 cut(s) 98
BtsI GCAGTG 1 cut(s) 74
BtsIMutI CAGTG 1 cut(s) 74
Cac8I GCNNGC 1 cut(s) 127
CviAII CATG 1 cut(s) 146
CviJI RGCY 2 cut(s) 58, 129
CviKI_1 RGCY 2 cut(s) 58, 129
DpnI GATC 1 cut(s) 100
DpnII GATC 1 cut(s) 98
Eam1104I CTCTTC 1 cut(s) 106
EarI CTCTTC 1 cut(s) 106
EcoRII CCWGG 3 cut(s) 27, 94, 149
FaeI CATG 1 cut(s) 149
FaiI YATR 2 cut(s) 147, 191
FatI CATG 1 cut(s) 145
Fnu4HI GCNGC 2 cut(s) 14, 123
Fsp4HI GCNGC 2 cut(s) 14, 123
FspBI CTAG 1 cut(s) 167
GluI GCNGC 2 cut(s) 14, 123
Hin1II CATG 1 cut(s) 149
HinfI GANTC 1 cut(s) 62
Hpy188III TCNNGA 1 cut(s) 132
HpyCH4V TGCA 1 cut(s) 160
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
Hsp92II CATG 1 cut(s) 149
Kzo9I GATC 1 cut(s) 98
LpnPI CCDG 9 cut(s) 14, 41, 44, 81, 102, 108, 117, 136, 163
Lsp1109I GCAGC 1 cut(s) 134
MaeI CTAG 1 cut(s) 167
MalI GATC 1 cut(s) 100
MboI GATC 1 cut(s) 98
MboII GAAGA 1 cut(s) 123
MflI RGATCY 1 cut(s) 98
MnlI CCTC 1 cut(s) 163
MseI TTAA 1 cut(s) 42
MspR9I CCNGG 3 cut(s) 29, 96, 151
MvaI CCWGG 3 cut(s) 29, 96, 151
MwoI GCNNNNNNNGC 1 cut(s) 64
NdeII GATC 1 cut(s) 98
NlaIII CATG 1 cut(s) 149
NlaIV GGNNCC 1 cut(s) 100
NspI RCATGY 1 cut(s) 149
PfeI GAWTC 1 cut(s) 62
PkrI GCNGC 2 cut(s) 15, 124
Psp6I CCWGG 3 cut(s) 27, 94, 149
PspGI CCWGG 3 cut(s) 27, 94, 149
PspN4I GGNNCC 1 cut(s) 100
PsuI RGATCY 1 cut(s) 98
SaqAI TTAA 1 cut(s) 42
SatI GCNGC 2 cut(s) 14, 123
Sau3AI GATC 1 cut(s) 98
ScrFI CCNGG 3 cut(s) 29, 96, 151
SetI ASST 4 cut(s) 49, 60, 91, 131
SspMI CTAG 1 cut(s) 167
StyD4I CCNGG 3 cut(s) 27, 94, 149
TaqI TCGA 1 cut(s) 21
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TscAI CASTG 1 cut(s) 74
TseI GCWGC 2 cut(s) 13, 122
TspDTI ATGAA 1 cut(s) 156
TspRI CASTG 1 cut(s) 74
XceI RCATGY 1 cut(s) 149
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.