Rh2AG134800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
12230322 .. 12231194
873 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG134800.1

Sequence Viewer

Length: 399 bp
ATGGCTTGGATACATCTTAATAGGGGAGCCAAAGAGGGCTTCAATTACAACTGGATGCTGAATTCAGACACCCTGGCCTGTTCAACGTTCTCATCAATTTCTTTAAAAACTTCCACTTTCATTTTTACTCCAGTGATGACGAGCTCTAGGTTTGGTCACCATGCCATCTCTTTACAACATGTTTCAACATTCAATGCTAAAATCAAAAACAAAAAATGGCTATGCCAGTCTACCAGATTTGAAGAATTTGTATGGATGAGTTTGGAATTATGTTTTGGAGAAACAAATAAGCATTTCAAAAGGTTGCGTTTAAAATTAGCACTAAAAGAAACTTCAATGCAAGGACTTTCCACTTATTGTAAATTGTTATATAAAAGCCGAGAGTTCATTGGTCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

15.4

Weight (kDa)

9.77

Isoelectric Point (pI)

36.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021406)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 230
AclI AACGTT 1 cut(s) 86
AcsI RAATTY 2 cut(s) 61, 245
AflIII ACRYGT 1 cut(s) 178
AgsI TTSAA 7 cut(s) 43, 84, 186, 193, 242, 298, 336
AjnI CCWGG 1 cut(s) 72
AjuI GAANNNNNNNTTGG 4 cut(s) 23, 55, 258, 290
AluBI AGCT 1 cut(s) 144
AluI AGCT 1 cut(s) 144
Alw21I GWGCWC 1 cut(s) 146
AoxI GGCC 1 cut(s) 75
ApoI RAATTY 2 cut(s) 61, 245
AsuHPI GGTGA 1 cut(s) 149
BanII GRGCYC 1 cut(s) 146
Bbv12I GWGCWC 1 cut(s) 146
BccI CCATC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 74
BciVI GTATCC 1 cut(s) 3
BfaI CTAG 1 cut(s) 147
BfuI GTATCC 1 cut(s) 3
Bme1390I CCNGG 1 cut(s) 74
BmiI GGNNCC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 74
BmsI GCATC 1 cut(s) 45
BpmI CTGGAG 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 72
Bse1I ACTGG 3 cut(s) 56, 131, 226
BseBI CCWGG 1 cut(s) 74
BseDI CCNNGG 1 cut(s) 72
BseGI GGATG 2 cut(s) 60, 261
BseNI ACTGG 3 cut(s) 56, 131, 226
BshFI GGCC 1 cut(s) 77
BsiHKAI GWGCWC 1 cut(s) 146
BsnI GGCC 1 cut(s) 77
Bsp1286I GDGCHC 1 cut(s) 146
BspANI GGCC 1 cut(s) 77
BspLI GGNNCC 1 cut(s) 28
BsrI ACTGG 3 cut(s) 56, 131, 226
BssECI CCNNGG 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 74
BstEII GGTNACC 1 cut(s) 155
BstF5I GGATG 2 cut(s) 60, 261
BstNI CCWGG 1 cut(s) 74
BstNSI RCATGY 1 cut(s) 182
BstPI GGTNACC 1 cut(s) 155
BstSCI CCNGG 1 cut(s) 72
BsuI GTATCC 1 cut(s) 3
BsuRI GGCC 1 cut(s) 77
BtsCI GGATG 2 cut(s) 60, 261
BtsIMutI CAGTG 1 cut(s) 138
CviAII CATG 2 cut(s) 161, 179
CviJI RGCY 7 cut(s) 5, 29, 39, 77, 144, 220, 378
CviKI_1 RGCY 7 cut(s) 5, 29, 39, 77, 144, 220, 378
DraI TTTAAA 2 cut(s) 105, 312
Ecl136II GAGCTC 1 cut(s) 144
Eco24I GRGCYC 1 cut(s) 146
Eco53kI GAGCTC 1 cut(s) 144
Eco91I GGTNACC 1 cut(s) 155
EcoICRI GAGCTC 1 cut(s) 144
EcoO65I GGTNACC 1 cut(s) 155
EcoRI GAATTC 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 72
EcoT38I GRGCYC 1 cut(s) 146
FaeI CATG 2 cut(s) 164, 182
FaiI YATR 7 cut(s) 162, 180, 223, 253, 271, 370, 372
FatI CATG 2 cut(s) 160, 178
FblI GTMKAC 1 cut(s) 230
FokI GGATG 2 cut(s) 67, 268
FriOI GRGCYC 1 cut(s) 146
FspBI CTAG 1 cut(s) 147
GsuI CTGGAG 1 cut(s) 114
HaeIII GGCC 1 cut(s) 77
Hin1II CATG 2 cut(s) 164, 182
HphI GGTGA 1 cut(s) 149
Hpy166II GTNNAC 1 cut(s) 231
Hpy188I TCNGA 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 231
HpyCH4IV ACGT 1 cut(s) 86
HpyCH4V TGCA 1 cut(s) 340
HpySE526I ACGT 1 cut(s) 86
Hsp92II CATG 2 cut(s) 164, 182
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 7 cut(s) 37, 59, 86, 91, 144, 239, 247
LweI GCATC 1 cut(s) 45
MaeI CTAG 1 cut(s) 147
MaeII ACGT 1 cut(s) 86
MaeIII GTNAC 2 cut(s) 155, 392
MboII GAAGA 1 cut(s) 254
MhlI GDGCHC 1 cut(s) 146
MluCI AATT 7 cut(s) 43, 61, 96, 245, 266, 314, 362
MnlI CCTC 1 cut(s) 28
MseI TTAA 3 cut(s) 18, 104, 311
MspR9I CCNGG 1 cut(s) 74
MvaI CCWGG 1 cut(s) 74
NlaIII CATG 2 cut(s) 164, 182
NlaIV GGNNCC 1 cut(s) 28
NmuCI GTSAC 2 cut(s) 155, 392
NspI RCATGY 1 cut(s) 182
PciI ACATGT 1 cut(s) 178
PscI ACATGT 1 cut(s) 178
Psp124BI GAGCTC 1 cut(s) 146
Psp1406I AACGTT 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 72
PspEI GGTNACC 1 cut(s) 155
PspGI CCWGG 1 cut(s) 72
PspN4I GGNNCC 1 cut(s) 28
SacI GAGCTC 1 cut(s) 146
SaqAI TTAA 3 cut(s) 18, 104, 311
ScrFI CCNGG 1 cut(s) 74
SduI GDGCHC 1 cut(s) 146
SetI ASST 4 cut(s) 89, 146, 152, 305
SfaNI GCATC 1 cut(s) 45
Sse9I AATT 7 cut(s) 43, 61, 96, 245, 266, 314, 362
SspMI CTAG 1 cut(s) 147
SstI GAGCTC 1 cut(s) 146
StyD4I CCNGG 1 cut(s) 72
TaiI ACGT 1 cut(s) 89
TasI AATT 7 cut(s) 43, 61, 96, 245, 266, 314, 362
Tru1I TTAA 3 cut(s) 18, 104, 311
Tru9I TTAA 3 cut(s) 18, 104, 311
TscAI CASTG 1 cut(s) 138
TseFI GTSAC 2 cut(s) 155, 392
Tsp45I GTSAC 2 cut(s) 155, 392
TspDTI ATGAA 2 cut(s) 109, 376
TspRI CASTG 1 cut(s) 138
XapI RAATTY 2 cut(s) 61, 245
XceI RCATGY 1 cut(s) 182
XmiI GTMKAC 1 cut(s) 230
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.