Rh2AG258700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0020021
Physical Location & Seq
Forward (+)
29608626 .. 29617955
9330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG258700.1

Sequence Viewer

Length: 390 bp
ATGTCTTCGTTGGAGGCTTTACAAAGCGAGAATGGGTTGCTGAGAAAAGCTGTGGAGGATCTCTGGCAAGAAATCGCCAGAGGGAGTTTGAATTCAGGGATGTACCGTGGAATGGAGTGTTGTGGGAATTGGGGCTCCAACAATAATGAGAAGAAGTCGCAGGAAGGAGATATATTTTTGAATGAAAAGAAATGGAAGTTAATAATGATTCAAAAGCATTTTGATTCAGTGTCGATGCCCAGCGCAGCATCGTCACCTATCTTAGCCGTCATCCTCAGCCAGGGTCCTCCTACACCAGTCGAATATGGTTATAATTATAAAGGTAGATTTTGCAACCATTATCCTGTATATATATATAATTCTATAATGTATTTGGTGGATAAGGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

14.62

Weight (kDa)

6.72

Isoelectric Point (pI)

53.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020021)

Species Orthologous Gene IDs
rosa_laevigata RLG00000016502
rosa_multiflora Rmu_sc0004576.1_g000005
rosa_samantha Rh2AG258700 Rh2AG258800 Rh2AG258900 Rh2AG524200 Rh2DG267100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 312, 318
AclWI GGATC 1 cut(s) 66
AcsI RAATTY 1 cut(s) 91
AfaI GTAC 1 cut(s) 104
AfiI CCNNNNNNNGG 2 cut(s) 112, 280
AgsI TTSAA 3 cut(s) 91, 181, 212
AjnI CCWGG 1 cut(s) 279
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
AlwI GGATC 1 cut(s) 66
ApeKI GCWGC 1 cut(s) 245
ApoI RAATTY 1 cut(s) 91
AspLEI GCGC 1 cut(s) 245
AspS9I GGNCC 1 cut(s) 284
AsuHPI GGTGA 1 cut(s) 246
AvaII GGWCC 1 cut(s) 284
BanII GRGCYC 1 cut(s) 137
BbvCI CCTCAGC 1 cut(s) 275
BbvI GCAGC 1 cut(s) 257
BceAI ACGGC 1 cut(s) 251
BciT130I CCWGG 1 cut(s) 281
BisI GCNGC 1 cut(s) 246
BlsI GCNGC 1 cut(s) 247
Bme1390I CCNGG 1 cut(s) 281
Bme18I GGWCC 1 cut(s) 284
BmgT120I GGNCC 1 cut(s) 284
BmiI GGNNCC 2 cut(s) 136, 285
BmrFI CCNGG 1 cut(s) 281
BmsI GCATC 2 cut(s) 225, 257
Bpu10I CCTNAGC 1 cut(s) 275
BsaJI CCNNGG 2 cut(s) 106, 280
Bsc4I CCNNNNNNNGG 2 cut(s) 112, 280
Bse1I ACTGG 1 cut(s) 296
BseBI CCWGG 1 cut(s) 281
BseDI CCNNGG 2 cut(s) 106, 280
BseGI GGATG 2 cut(s) 105, 270
BseLI CCNNNNNNNGG 2 cut(s) 112, 280
BseMII CTCAG 2 cut(s) 32, 289
BseNI ACTGG 1 cut(s) 296
BseXI GCAGC 1 cut(s) 257
BseYI CCCAGC 1 cut(s) 239
BslI CCNNNNNNNGG 2 cut(s) 112, 280
Bsp1286I GDGCHC 1 cut(s) 137
Bsp143I GATC 1 cut(s) 58
BspCNI CTCAG 2 cut(s) 33, 288
BspLI GGNNCC 2 cut(s) 136, 285
BspPI GGATC 1 cut(s) 66
BsrI ACTGG 1 cut(s) 296
BssECI CCNNGG 2 cut(s) 106, 280
BssMI GATC 1 cut(s) 58
Bst2UI CCWGG 1 cut(s) 281
Bst4CI ACNGT 1 cut(s) 107
BstDEI CTNAG 3 cut(s) 41, 262, 275
BstDSI CCRYGG 1 cut(s) 106
BstENI CCTNNNNNAGG 1 cut(s) 278
BstF5I GGATG 2 cut(s) 105, 270
BstHHI GCGC 1 cut(s) 245
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstNI CCWGG 1 cut(s) 281
BstSCI CCNGG 1 cut(s) 279
BstV1I GCAGC 1 cut(s) 257
BstX2I RGATCY 1 cut(s) 58
BstYI RGATCY 1 cut(s) 58
BtgI CCRYGG 1 cut(s) 106
BtsCI GGATG 2 cut(s) 105, 270
BtsIMutI CAGTG 1 cut(s) 234
CfoI GCGC 1 cut(s) 245
Cfr13I GGNCC 1 cut(s) 284
Csp6I GTAC 1 cut(s) 103
CviJI RGCY 5 cut(s) 17, 50, 135, 266, 279
CviKI_1 RGCY 5 cut(s) 17, 50, 135, 266, 279
CviQI GTAC 1 cut(s) 103
DdeI CTNAG 3 cut(s) 41, 262, 275
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
Eco24I GRGCYC 1 cut(s) 137
Eco47I GGWCC 1 cut(s) 284
EcoNI CCTNNNNNAGG 1 cut(s) 278
EcoO109I RGGNCCY 1 cut(s) 284
EcoRI GAATTC 1 cut(s) 91
EcoRII CCWGG 1 cut(s) 279
EcoT38I GRGCYC 1 cut(s) 137
Fnu4HI GCNGC 1 cut(s) 246
FokI GGATG 2 cut(s) 112, 257
FriOI GRGCYC 1 cut(s) 137
Fsp4HI GCNGC 1 cut(s) 246
GlaI GCGC 1 cut(s) 244
GluI GCNGC 1 cut(s) 246
GsaI CCCAGC 1 cut(s) 243
HhaI GCGC 1 cut(s) 245
Hin6I GCGC 1 cut(s) 243
HinP1I GCGC 1 cut(s) 243
HinfI GANTC 2 cut(s) 208, 224
HphI GGTGA 1 cut(s) 246
HpyAV CCTTC 1 cut(s) 158
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 333
HpyF3I CTNAG 3 cut(s) 41, 262, 275
HspAI GCGC 1 cut(s) 243
Kzo9I GATC 1 cut(s) 58
LmnI GCTCC 1 cut(s) 140
LpnPI CCDG 9 cut(s) 49, 81, 91, 146, 253, 266, 293, 309, 357
Lsp1109I GCAGC 1 cut(s) 257
LweI GCATC 2 cut(s) 225, 257
MaeIII GTNAC 1 cut(s) 252
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 1 cut(s) 163
MflI RGATCY 1 cut(s) 58
MhlI GDGCHC 1 cut(s) 137
MluCI AATT 4 cut(s) 91, 127, 313, 358
MmeI TCCRAC 1 cut(s) 162
MnlI CCTC 5 cut(s) 7, 49, 74, 284, 297
MseI TTAA 1 cut(s) 200
MspR9I CCNGG 1 cut(s) 281
MvaI CCWGG 1 cut(s) 281
NdeII GATC 1 cut(s) 58
NlaIV GGNNCC 2 cut(s) 136, 285
NmuCI GTSAC 1 cut(s) 252
PfeI GAWTC 2 cut(s) 208, 224
PkrI GCNGC 1 cut(s) 247
PpuMI RGGWCCY 1 cut(s) 284
PsiI TTATAA 2 cut(s) 312, 318
Psp5II RGGWCCY 1 cut(s) 284
Psp6I CCWGG 1 cut(s) 279
PspFI CCCAGC 1 cut(s) 239
PspGI CCWGG 1 cut(s) 279
PspN4I GGNNCC 2 cut(s) 136, 285
PspPI GGNCC 1 cut(s) 284
PspPPI RGGWCCY 1 cut(s) 284
PsuI RGATCY 1 cut(s) 58
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
SaqAI TTAA 1 cut(s) 200
SatI GCNGC 1 cut(s) 246
Sau3AI GATC 1 cut(s) 58
Sau96I GGNCC 1 cut(s) 284
ScrFI CCNGG 1 cut(s) 281
SduI GDGCHC 1 cut(s) 137
SetI ASST 4 cut(s) 52, 259, 325, 387
SfaNI GCATC 2 cut(s) 225, 257
SinI GGWCC 1 cut(s) 284
Sse9I AATT 4 cut(s) 91, 127, 313, 358
StyD4I CCNGG 1 cut(s) 279
TaaI ACNGT 1 cut(s) 107
TaqI TCGA 2 cut(s) 233, 300
TasI AATT 4 cut(s) 91, 127, 313, 358
TfiI GAWTC 2 cut(s) 208, 224
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TscAI CASTG 1 cut(s) 234
TseFI GTSAC 1 cut(s) 252
TseI GCWGC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 252
TspDTI ATGAA 1 cut(s) 198
TspRI CASTG 1 cut(s) 234
VpaK11BI GGWCC 1 cut(s) 284
XagI CCTNNNNNAGG 1 cut(s) 278
XapI RAATTY 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.