Rh2AG492500
MYB Family

RNA polymerase II transcription regulator recruiting activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
71418053 .. 71419562
1510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG492500.1

Sequence Viewer

Length: 399 bp
ATGTATGTGCAAAATTTCTTGTTTCTAAGGTGGTCTTTGATTGCGGGAAGATTACCGGGTCGAACAGACAATGAGATAAAGAACTACTGGAATACCCATTTGAGCAAGAAAATTAACCAGAAAGAGAAGCAAAGTAGCAATGGAGCAAATTCGACAATACAAATTCCCACAGTTGACGAGAAACCAAGTGTAGCAGATGATGATCGGAAGGTCCATGTAGAAATGAAGCAAGAGTGCTTATCATCAGGAGTGGGTACAAGTGCGGCTCTAATAAAGAAAGAGGTGATGATCGATCCTGAGGATTACTCCAACACTAACATTAACAATATTGATGTTGATGACTTCTTTAATCTCCTCGATAAAGAACCTTTGAGTTGGGAGGTTCCGCAAATTCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

15.07

Weight (kDa)

4.99

Isoelectric Point (pI)

36.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 10 - 34 2.2e-08 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017340)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 44, 263, 386
AclWI GGATC 1 cut(s) 287
AcsI RAATTY 4 cut(s) 13, 148, 162, 390
AfaI GTAC 1 cut(s) 256
AlwI GGATC 1 cut(s) 287
ApoI RAATTY 4 cut(s) 13, 148, 162, 390
AspS9I GGNCC 1 cut(s) 211
AsuC2I CCSGG 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 295
AvaII GGWCC 1 cut(s) 211
AxyI CCTNAGG 1 cut(s) 297
BcnI CCSGG 1 cut(s) 57
BisI GCNGC 1 cut(s) 264
BlsI GCNGC 1 cut(s) 265
Bme1390I CCNGG 1 cut(s) 57
Bme18I GGWCC 1 cut(s) 211
BmgT120I GGNCC 1 cut(s) 211
BmiI GGNNCC 1 cut(s) 384
BmrFI CCNGG 1 cut(s) 57
BplI GAGNNNNNCTC 2 cut(s) 290, 322
BpuMI CCSGG 1 cut(s) 57
Bsa29I ATCGAT 1 cut(s) 291
BsaBI GATNNNNATC 1 cut(s) 201
Bse1I ACTGG 1 cut(s) 92
Bse21I CCTNAGG 1 cut(s) 297
Bse3DI GCAATG 1 cut(s) 145
Bse8I GATNNNNATC 1 cut(s) 201
BseCI ATCGAT 1 cut(s) 291
BseJI GATNNNNATC 1 cut(s) 201
BseMI GCAATG 1 cut(s) 145
BseMII CTCAG 1 cut(s) 288
BseNI ACTGG 1 cut(s) 92
BseRI GAGGAG 1 cut(s) 344
BshVI ATCGAT 1 cut(s) 291
BsiSI CCGG 1 cut(s) 56
Bsp143I GATC 3 cut(s) 202, 288, 292
BspACI CCGC 3 cut(s) 44, 263, 386
BspCNI CTCAG 1 cut(s) 289
BspDI ATCGAT 1 cut(s) 291
BspLI GGNNCC 1 cut(s) 384
BspPI GGATC 1 cut(s) 287
BsrDI GCAATG 1 cut(s) 145
BsrI ACTGG 1 cut(s) 92
BssMI GATC 3 cut(s) 202, 288, 292
Bst4CI ACNGT 1 cut(s) 172
BstDEI CTNAG 2 cut(s) 26, 297
BstKTI GATC 3 cut(s) 205, 291, 295
BstMBI GATC 3 cut(s) 202, 288, 292
BstSCI CCNGG 1 cut(s) 55
Bsu15I ATCGAT 1 cut(s) 291
Bsu36I CCTNAGG 1 cut(s) 297
BsuTUI ATCGAT 1 cut(s) 291
Cfr13I GGNCC 1 cut(s) 211
ClaI ATCGAT 1 cut(s) 291
Csp6I GTAC 1 cut(s) 255
CviAII CATG 1 cut(s) 215
CviJI RGCY 1 cut(s) 266
CviKI_1 RGCY 1 cut(s) 266
CviQI GTAC 1 cut(s) 255
DdeI CTNAG 2 cut(s) 26, 297
DpnI GATC 3 cut(s) 204, 290, 294
DpnII GATC 3 cut(s) 202, 288, 292
Eco47I GGWCC 1 cut(s) 211
Eco81I CCTNAGG 1 cut(s) 297
FaeI CATG 1 cut(s) 218
FaiI YATR 2 cut(s) 6, 216
FalI AAGNNNNNCTT 2 cut(s) 19, 51
FatI CATG 1 cut(s) 214
FauI CCCGC 1 cut(s) 37
Fnu4HI GCNGC 1 cut(s) 264
Fsp4HI GCNGC 1 cut(s) 264
GluI GCNGC 1 cut(s) 264
HapII CCGG 1 cut(s) 56
Hin1II CATG 1 cut(s) 218
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
HpaII CCGG 1 cut(s) 56
HphI GGTGA 1 cut(s) 295
Hpy166II GTNNAC 1 cut(s) 175
Hpy188I TCNGA 1 cut(s) 207
Hpy188III TCNNGA 2 cut(s) 246, 296
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 172
HpyCH4V TGCA 1 cut(s) 10
HpyF3I CTNAG 2 cut(s) 26, 297
Hsp92II CATG 1 cut(s) 218
Kzo9I GATC 3 cut(s) 202, 288, 292
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 5 cut(s) 69, 73, 131, 231, 309
MalI GATC 3 cut(s) 204, 290, 294
MboI GATC 3 cut(s) 202, 288, 292
MboII GAAGA 1 cut(s) 60
MluCI AATT 5 cut(s) 13, 111, 148, 162, 390
MmeI TCCRAC 1 cut(s) 333
MnlI CCTC 4 cut(s) 274, 292, 365, 373
MseI TTAA 3 cut(s) 114, 321, 348
MspI CCGG 1 cut(s) 56
MspR9I CCNGG 1 cut(s) 57
NciI CCSGG 1 cut(s) 57
NdeII GATC 3 cut(s) 202, 288, 292
NlaIII CATG 1 cut(s) 218
NlaIV GGNNCC 1 cut(s) 384
PkrI GCNGC 1 cut(s) 265
PspN4I GGNNCC 1 cut(s) 384
PspPI GGNCC 1 cut(s) 211
RsaI GTAC 1 cut(s) 256
RsaNI GTAC 1 cut(s) 255
SaqAI TTAA 3 cut(s) 114, 321, 348
SatI GCNGC 1 cut(s) 264
Sau3AI GATC 3 cut(s) 202, 288, 292
Sau96I GGNCC 1 cut(s) 211
ScrFI CCNGG 1 cut(s) 57
SetI ASST 5 cut(s) 32, 213, 285, 370, 384
SinI GGWCC 1 cut(s) 211
Sse9I AATT 5 cut(s) 13, 111, 148, 162, 390
SsiI CCGC 3 cut(s) 44, 263, 386
SspI AATATT 1 cut(s) 328
StyD4I CCNGG 1 cut(s) 55
TaaI ACNGT 1 cut(s) 172
TaqI TCGA 4 cut(s) 61, 152, 291, 357
TasI AATT 5 cut(s) 13, 111, 148, 162, 390
TauI GCSGC 1 cut(s) 266
Tru1I TTAA 3 cut(s) 114, 321, 348
Tru9I TTAA 3 cut(s) 114, 321, 348
TspDTI ATGAA 1 cut(s) 239
VpaK11BI GGWCC 1 cut(s) 211
XapI RAATTY 4 cut(s) 13, 148, 162, 390
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.