Rh2BG245400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
24986054 .. 24987880
1827 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG245400.1

Sequence Viewer

Length: 258 bp
ATGGCAACCATCAATGGCTTCCACCTTCACATGTCCAGCCTCAGAAGCCAAGAACACAAGTCCCAAGTCCTGCATGGTACTAATTTGCTGTGTCTCCATGAGAGTACTCCTCATCCAAGATCATCATCATTCAACAAAGTTCCAAGAAAACCCAGCCATGATTACAGACTGATCACAAAGGCAACGTCTCATGCATCAGATAGTTCTCCACCAGAACCTCATCAAGTTCCGGCCAAATCCCCATTCTCTGCCTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.49

Weight (kDa)

9.74

Isoelectric Point (pI)

71.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015521)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 231
AfaI GTAC 2 cut(s) 79, 106
AflIII ACRYGT 1 cut(s) 30
AgsI TTSAA 1 cut(s) 133
AjnI CCWGG 1 cut(s) 251
AjuI GAANNNNNNNTTGG 1 cut(s) 227
Alw26I GTCTC 2 cut(s) 98, 192
AoxI GGCC 1 cut(s) 231
ArsI GACNNNNNNTTYG 2 cut(s) 170, 202
BccI CCATC 1 cut(s) 17
BciT130I CCWGG 1 cut(s) 253
BclI TGATCA 1 cut(s) 171
BcoDI GTCTC 2 cut(s) 98, 192
BmcAI AGTACT 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 253
BmrFI CCNGG 1 cut(s) 253
BmsI GCATC 1 cut(s) 203
BplI GAGNNNNNCTC 2 cut(s) 94, 126
BsaBI GATNNNNATC 1 cut(s) 124
Bse8I GATNNNNATC 1 cut(s) 124
BseBI CCWGG 1 cut(s) 253
BseGI GGATG 1 cut(s) 112
BseJI GATNNNNATC 1 cut(s) 124
BseMII CTCAG 1 cut(s) 55
BseRI GAGGAG 1 cut(s) 99
BseYI CCCAGC 1 cut(s) 152
BshFI GGCC 1 cut(s) 233
BsiSI CCGG 1 cut(s) 230
BslFI GGGAC 1 cut(s) 46
BsmAI GTCTC 2 cut(s) 98, 192
BsmBI CGTCTC 1 cut(s) 192
BsmFI GGGAC 1 cut(s) 46
BsnI GGCC 1 cut(s) 233
Bsp143I GATC 2 cut(s) 119, 171
BspANI GGCC 1 cut(s) 233
BspCNI CTCAG 1 cut(s) 54
BssMI GATC 2 cut(s) 119, 171
Bst2UI CCWGG 1 cut(s) 253
BstDEI CTNAG 1 cut(s) 41
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 2 cut(s) 122, 174
BstMAI GTCTC 2 cut(s) 98, 192
BstMBI GATC 2 cut(s) 119, 171
BstMWI GCNNNNNNNGC 1 cut(s) 45
BstNI CCWGG 1 cut(s) 253
BstNSI RCATGY 1 cut(s) 34
BstSCI CCNGG 1 cut(s) 251
BsuRI GGCC 1 cut(s) 233
BtsCI GGATG 1 cut(s) 112
Csp6I GTAC 2 cut(s) 78, 105
CviAII CATG 5 cut(s) 31, 74, 98, 158, 191
CviJI RGCY 5 cut(s) 18, 39, 48, 156, 233
CviKI_1 RGCY 5 cut(s) 18, 39, 48, 156, 233
CviQI GTAC 2 cut(s) 78, 105
DdeI CTNAG 1 cut(s) 41
DpnI GATC 2 cut(s) 121, 173
DpnII GATC 2 cut(s) 119, 171
EaeI YGGCCR 1 cut(s) 231
EcoRII CCWGG 1 cut(s) 251
EcoT22I ATGCAT 1 cut(s) 196
Esp3I CGTCTC 1 cut(s) 192
FaeI CATG 5 cut(s) 34, 77, 101, 161, 194
FaiI YATR 5 cut(s) 32, 75, 99, 159, 192
FaqI GGGAC 1 cut(s) 46
FatI CATG 5 cut(s) 30, 73, 97, 157, 190
FbaI TGATCA 1 cut(s) 171
FokI GGATG 1 cut(s) 99
GsaI CCCAGC 1 cut(s) 156
HaeIII GGCC 1 cut(s) 233
HapII CCGG 1 cut(s) 230
Hin1II CATG 5 cut(s) 34, 77, 101, 161, 194
HpaII CCGG 1 cut(s) 230
Hpy188I TCNGA 2 cut(s) 44, 199
HpyAV CCTTC 1 cut(s) 35
HpyCH4IV ACGT 1 cut(s) 185
HpyCH4V TGCA 2 cut(s) 73, 194
HpyF10VI GCNNNNNNNGC 1 cut(s) 45
HpyF3I CTNAG 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 185
Hsp92II CATG 5 cut(s) 34, 77, 101, 161, 194
Ksp22I TGATCA 1 cut(s) 171
Kzo9I GATC 2 cut(s) 119, 171
LpnPI CCDG 6 cut(s) 49, 83, 166, 225, 238, 243
LweI GCATC 1 cut(s) 203
MaeII ACGT 1 cut(s) 185
MalI GATC 2 cut(s) 121, 173
MboI GATC 2 cut(s) 119, 171
MluCI AATT 1 cut(s) 82
MnlI CCTC 3 cut(s) 50, 120, 228
Mph1103I ATGCAT 1 cut(s) 196
MspI CCGG 1 cut(s) 230
MspR9I CCNGG 1 cut(s) 253
MvaI CCWGG 1 cut(s) 253
MwoI GCNNNNNNNGC 1 cut(s) 45
NdeII GATC 2 cut(s) 119, 171
NlaIII CATG 5 cut(s) 34, 77, 101, 161, 194
NsiI ATGCAT 1 cut(s) 196
NspI RCATGY 1 cut(s) 34
PciI ACATGT 1 cut(s) 30
PscI ACATGT 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 251
PspFI CCCAGC 1 cut(s) 152
PspGI CCWGG 1 cut(s) 251
RsaI GTAC 2 cut(s) 79, 106
RsaNI GTAC 2 cut(s) 78, 105
Sau3AI GATC 2 cut(s) 119, 171
ScaI AGTACT 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 253
SetI ASST 3 cut(s) 27, 188, 220
SfaNI GCATC 1 cut(s) 203
Sse9I AATT 1 cut(s) 82
StyD4I CCNGG 1 cut(s) 251
TaiI ACGT 1 cut(s) 188
TasI AATT 1 cut(s) 82
TatI WGTACW 1 cut(s) 104
XceI RCATGY 1 cut(s) 34
XcmI CCANNNNNNNNNTGG 2 cut(s) 71, 249
ZrmI AGTACT 1 cut(s) 106
Zsp2I ATGCAT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.