Rh2CG175700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
16065651 .. 16070545
4895 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG175700.1

Sequence Viewer

Length: 366 bp
ATGGCAGCAGATCGAAGAGGGTTAAGGAACAGCGACGACATAGCTTTAGGGGTTGTGTGCGGTGGTTTGGCGATCTCGATCGAGGGTGGGGTGGCTGAGTTTTGTTCTCCATTGCCTAGGCTATCTTTTGGTGGTGGCAATGCCAAAAGTCGAGGACCGAAAGTCGAGCTTTCAGGCGTAACAGAGAGATGGATTGCGGCTGGATACCTGCATCTAAGGATTCTAGGCAACAGTAGCTCCGCAGTTTGGTATCAACCCCTAACAAAAATCGAAAGAGAGAATGACGAAGTTAAGGAAGCTAAACCGAATTGCGGCTCATCACAGATCTATACTGAGGACGATGGTGTTGCAGTTCGTGAAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

12.88

Weight (kDa)

5.41

Isoelectric Point (pI)

47.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020729)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 216
AciI CCGC 4 cut(s) 60, 197, 240, 312
AfiI CCNNNNNNNGG 2 cut(s) 246, 311
AhdI GACNNNNNGTC 1 cut(s) 161
AluBI AGCT 4 cut(s) 44, 169, 237, 299
AluI AGCT 4 cut(s) 44, 169, 237, 299
ApeKI GCWGC 1 cut(s) 5
AspA2I CCTAGG 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 155
AvaII GGWCC 1 cut(s) 155
AvrII CCTAGG 1 cut(s) 116
BbvI GCAGC 1 cut(s) 17
BccI CCATC 2 cut(s) 183, 335
BcgI CGANNNNNNTGC 2 cut(s) 329, 363
BciVI GTATCC 1 cut(s) 197
BfaI CTAG 2 cut(s) 117, 224
BfuAI ACCTGC 1 cut(s) 216
BfuI GTATCC 1 cut(s) 197
BglII AGATCT 1 cut(s) 324
BisI GCNGC 3 cut(s) 6, 198, 313
BlnI CCTAGG 1 cut(s) 116
BlsI GCNGC 3 cut(s) 7, 199, 314
Bme18I GGWCC 1 cut(s) 155
BmeRI GACNNNNNGTC 1 cut(s) 161
BmgT120I GGNCC 1 cut(s) 155
BmsI GCATC 1 cut(s) 220
BsaBI GATNNNNATC 1 cut(s) 77
BsaJI CCNNGG 1 cut(s) 116
BsaXI ACNNNNNCTCC 2 cut(s) 221, 251
Bsc4I CCNNNNNNNGG 2 cut(s) 246, 311
Bse3DI GCAATG 2 cut(s) 110, 145
Bse8I GATNNNNATC 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 116
BseJI GATNNNNATC 1 cut(s) 77
BseLI CCNNNNNNNGG 2 cut(s) 246, 311
BseMI GCAATG 2 cut(s) 110, 145
BseMII CTCAG 2 cut(s) 87, 324
BseXI GCAGC 1 cut(s) 17
Bsh1285I CGRYCG 1 cut(s) 81
BsiEI CGRYCG 1 cut(s) 81
BslI CCNNNNNNNGG 2 cut(s) 246, 311
Bsp143I GATC 4 cut(s) 10, 72, 78, 324
BspACI CCGC 4 cut(s) 60, 197, 240, 312
BspCNI CTCAG 2 cut(s) 88, 325
BspMI ACCTGC 1 cut(s) 216
BsrDI GCAATG 2 cut(s) 110, 145
BssECI CCNNGG 1 cut(s) 116
BssMI GATC 4 cut(s) 10, 72, 78, 324
BssT1I CCWWGG 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 233
Bst6I CTCTTC 1 cut(s) 10
BstDEI CTNAG 3 cut(s) 96, 215, 333
BstKTI GATC 4 cut(s) 13, 75, 81, 327
BstMBI GATC 4 cut(s) 10, 72, 78, 324
BstMCI CGRYCG 1 cut(s) 81
BstMWI GCNNNNNNNGC 1 cut(s) 234
BstV1I GCAGC 1 cut(s) 17
BstX2I RGATCY 1 cut(s) 324
BstYI RGATCY 1 cut(s) 324
BsuI GTATCC 1 cut(s) 197
BveI ACCTGC 1 cut(s) 216
Cfr13I GGNCC 1 cut(s) 155
CviAII CATG 1 cut(s) 363
CviJI RGCY 8 cut(s) 44, 95, 121, 169, 200, 237, 299, 315
CviKI_1 RGCY 8 cut(s) 44, 95, 121, 169, 200, 237, 299, 315
DdeI CTNAG 3 cut(s) 96, 215, 333
DpnI GATC 4 cut(s) 12, 74, 80, 326
DpnII GATC 4 cut(s) 10, 72, 78, 324
DriI GACNNNNNGTC 1 cut(s) 161
Eam1104I CTCTTC 1 cut(s) 10
Eam1105I GACNNNNNGTC 1 cut(s) 161
EarI CTCTTC 1 cut(s) 10
Eco130I CCWWGG 1 cut(s) 116
Eco47I GGWCC 1 cut(s) 155
EcoT14I CCWWGG 1 cut(s) 116
ErhI CCWWGG 1 cut(s) 116
FaeI CATG 1 cut(s) 366
FaiI YATR 3 cut(s) 41, 330, 364
FalI AAGNNNNNCTT 2 cut(s) 153, 185
FatI CATG 1 cut(s) 362
Fnu4HI GCNGC 3 cut(s) 6, 198, 313
Fsp4HI GCNGC 3 cut(s) 6, 198, 313
FspBI CTAG 2 cut(s) 117, 224
GluI GCNGC 3 cut(s) 6, 198, 313
Hin1II CATG 1 cut(s) 366
HinfI GANTC 1 cut(s) 220
Hpy188III TCNNGA 2 cut(s) 76, 356
Hpy99I CGWCG 1 cut(s) 38
HpyCH4III ACNGT 1 cut(s) 233
HpyCH4V TGCA 2 cut(s) 211, 350
HpyF10VI GCNNNNNNNGC 1 cut(s) 234
HpyF3I CTNAG 3 cut(s) 96, 215, 333
Hsp92II CATG 1 cut(s) 366
Kzo9I GATC 4 cut(s) 10, 72, 78, 324
LmnI GCTCC 1 cut(s) 242
LpnPI CCDG 3 cut(s) 159, 186, 221
Lsp1109I GCAGC 1 cut(s) 17
LweI GCATC 1 cut(s) 220
MaeI CTAG 2 cut(s) 117, 224
MaeIII GTNAC 1 cut(s) 178
MalI GATC 4 cut(s) 12, 74, 80, 326
MboI GATC 4 cut(s) 10, 72, 78, 324
MboII GAAGA 1 cut(s) 27
MflI RGATCY 1 cut(s) 324
MluCI AATT 1 cut(s) 307
MnlI CCTC 4 cut(s) 11, 76, 146, 328
MseI TTAA 2 cut(s) 23, 291
MwoI GCNNNNNNNGC 1 cut(s) 234
NdeII GATC 4 cut(s) 10, 72, 78, 324
NlaIII CATG 1 cut(s) 366
PfeI GAWTC 1 cut(s) 220
PkrI GCNGC 3 cut(s) 7, 199, 314
Ple19I CGATCG 1 cut(s) 81
PspPI GGNCC 1 cut(s) 155
PsuI RGATCY 1 cut(s) 324
PvuI CGATCG 1 cut(s) 81
SaqAI TTAA 2 cut(s) 23, 291
SatI GCNGC 3 cut(s) 6, 198, 313
Sau3AI GATC 4 cut(s) 10, 72, 78, 324
Sau96I GGNCC 1 cut(s) 155
SetI ASST 5 cut(s) 46, 171, 210, 239, 301
SfaNI GCATC 1 cut(s) 220
SgeI CNNG 9 cut(s) 88, 94, 129, 164, 178, 186, 213, 220, 236
SinI GGWCC 1 cut(s) 155
Sse9I AATT 1 cut(s) 307
SsiI CCGC 4 cut(s) 60, 197, 240, 312
SspMI CTAG 2 cut(s) 117, 224
StyI CCWWGG 1 cut(s) 116
TaaI ACNGT 1 cut(s) 233
TaqI TCGA 6 cut(s) 13, 77, 81, 151, 165, 270
TaqII GACCGA 1 cut(s) 172
TasI AATT 1 cut(s) 307
TauI GCSGC 2 cut(s) 200, 315
TfiI GAWTC 1 cut(s) 220
Tru1I TTAA 2 cut(s) 23, 291
Tru9I TTAA 2 cut(s) 23, 291
TseI GCWGC 1 cut(s) 5
VpaK11BI GGWCC 1 cut(s) 155
XmaJI CCTAGG 1 cut(s) 116
XspI CTAG 2 cut(s) 117, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.