Rh4BG279000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
45301478 .. 45320468
18991 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG279000.1

Sequence Viewer

Length: 243 bp
ATGGCTTTGCATCTAACACTTTCGAATCCTTCAGATCTTCTAGTTTCCTTCAGCCTCGTCTTGTCACAATCTCTCCCTCAGTTGGTGCCTATAACTGACACACACATTGTAATTGATGGAGAGCAAATTGAGACCTCCACAAGTCCGAGGCTCAAATTTTCAACAAGCAGGATGATCTTTTCCTATCTGAAAATTATTTCCATACACACTCGGGAAAAACCAGAGGTGCAAATAAAAATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.02

Weight (kDa)

6.82

Isoelectric Point (pI)

46.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020729)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 85
AcsI RAATTY 1 cut(s) 155
AcuI CTGAAG 2 cut(s) 15, 34
AfiI CCNNNNNNNGG 1 cut(s) 82
AgsI TTSAA 1 cut(s) 162
Alw26I GTCTC 1 cut(s) 125
Ama87I CYCGRG 1 cut(s) 210
ApoI RAATTY 1 cut(s) 155
AsuII TTCGAA 1 cut(s) 23
AvaI CYCGRG 1 cut(s) 210
BanI GGYRCC 1 cut(s) 85
BccI CCATC 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 125
BfaI CTAG 1 cut(s) 41
BglII AGATCT 1 cut(s) 34
BmeT110I CYCGRG 1 cut(s) 210
BmiI GGNNCC 1 cut(s) 87
BmsI GCATC 1 cut(s) 19
Bpu14I TTCGAA 1 cut(s) 23
BsaI GGTCTC 1 cut(s) 125
BsaJI CCNNGG 1 cut(s) 146
BsaXI ACNNNNNCTCC 2 cut(s) 57, 87
Bsc4I CCNNNNNNNGG 1 cut(s) 82
BseDI CCNNGG 1 cut(s) 146
BseGI GGATG 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 82
BseMII CTCAG 1 cut(s) 92
BshNI GGYRCC 1 cut(s) 85
BsiHKCI CYCGRG 1 cut(s) 210
BslI CCNNNNNNNGG 1 cut(s) 82
BsmAI GTCTC 1 cut(s) 125
Bso31I GGTCTC 1 cut(s) 125
BsoBI CYCGRG 1 cut(s) 210
Bsp119I TTCGAA 1 cut(s) 23
Bsp143I GATC 2 cut(s) 34, 174
BspCNI CTCAG 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 87
BspT104I TTCGAA 1 cut(s) 23
BspT107I GGYRCC 1 cut(s) 85
BspTNI GGTCTC 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 146
BssMI GATC 2 cut(s) 34, 174
BstBI TTCGAA 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 78
BstF5I GGATG 1 cut(s) 177
BstKTI GATC 2 cut(s) 37, 177
BstMAI GTCTC 1 cut(s) 125
BstMBI GATC 2 cut(s) 34, 174
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
BtsCI GGATG 1 cut(s) 177
CviJI RGCY 3 cut(s) 5, 54, 151
CviKI_1 RGCY 3 cut(s) 5, 54, 151
DdeI CTNAG 1 cut(s) 78
DpnI GATC 2 cut(s) 36, 176
DpnII GATC 2 cut(s) 34, 174
Eco31I GGTCTC 1 cut(s) 125
Eco57I CTGAAG 2 cut(s) 15, 34
Eco88I CYCGRG 1 cut(s) 210
FaiI YATR 2 cut(s) 92, 203
FokI GGATG 1 cut(s) 184
FspBI CTAG 1 cut(s) 41
HinfI GANTC 1 cut(s) 25
Hpy188I TCNGA 3 cut(s) 34, 147, 189
Hpy188III TCNNGA 1 cut(s) 212
HpyAV CCTTC 2 cut(s) 39, 58
HpyCH4V TGCA 2 cut(s) 10, 229
HpyF3I CTNAG 1 cut(s) 78
Kzo9I GATC 2 cut(s) 34, 174
LpnPI CCDG 2 cut(s) 154, 234
LweI GCATC 1 cut(s) 19
MaeI CTAG 1 cut(s) 41
MaeIII GTNAC 1 cut(s) 63
MalI GATC 2 cut(s) 36, 176
MboI GATC 2 cut(s) 34, 174
MboII GAAGA 1 cut(s) 29
MflI RGATCY 1 cut(s) 34
MluCI AATT 4 cut(s) 111, 126, 155, 192
MnlI CCTC 5 cut(s) 65, 87, 141, 145, 217
NdeII GATC 2 cut(s) 34, 174
NlaIV GGNNCC 1 cut(s) 87
NmuCI GTSAC 1 cut(s) 63
NspV TTCGAA 1 cut(s) 23
PfeI GAWTC 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 87
PsuI RGATCY 1 cut(s) 34
Sau3AI GATC 2 cut(s) 34, 174
SetI ASST 2 cut(s) 137, 228
SfaNI GCATC 1 cut(s) 19
SfuI TTCGAA 1 cut(s) 23
Sse9I AATT 4 cut(s) 111, 126, 155, 192
SspMI CTAG 1 cut(s) 41
TaqI TCGA 1 cut(s) 23
TasI AATT 4 cut(s) 111, 126, 155, 192
TfiI GAWTC 1 cut(s) 25
TseFI GTSAC 1 cut(s) 63
Tsp45I GTSAC 1 cut(s) 63
XapI RAATTY 1 cut(s) 155
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.