Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2C

Orthogroup ID

OG0014348

Physical Location & Seq

Genomic Coordinates Reverse (-)

72823896 .. 72827320

Gene Structure 3425 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2CG548200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 231 bp

ATGAAGCAGAAGGCTATGAAGGAGTGTAAGGATTACGCTTCCAAATATGCAGAGTGCTCTACTGGGAGAACCATCTCCGTTGTTTGGCAGTGTCGCCAAGAAGCTAAGGAATTGAACAATTGCCTTCACCAATTCACTAATGATGATGTCTTGGAGCAAATGAAAAAAGATTACATGCTTCAACAACAGCAGAAGGAATCTACCAGAAGTCTAAATCCATCTGCTATCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cmc1

Protein Analysis

76

Amino Acids

8.91

Weight (kDa)

8.37

Isoelectric Point (pI)

63.6

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Cmc1	PF08583	1 - 62	4.4e-14	Cytochrome c oxidase biogenesis protein Cmc1 like

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014348)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G16060
fragaria_vesca	FvH4_6g45250
malus_domestica	MD07G1095900.v1.1 MD17G1105000.v1.1
prunus_persica	Prupe.3G238900_v2.0.a1 Prupe.3G238900_v2.0.a1
pyrus_communis	pycom09g01120 pycom17g07570
rosa_chinensis	RchiOBHm_Chr2g0162971
rosa_multiflora	Rmu_sc0011038.1_g000003
rosa_roxburghii	Rroxscaffold_2G00087650
rosa_rugosa	Rorug02G0499600
rosa_samantha	Rh2AG565800 Rh2BG578400 Rh2CG548200 Rh2DG588600
rosa_wichuraiana	Rw2G046850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	84
AgsI	TTSAA	2 cut(s)	115, 182
AluBI	AGCT	1 cut(s)	104
AluI	AGCT	1 cut(s)	104
Alw21I	GWGCWC	1 cut(s)	59
AsuHPI	GGTGA	1 cut(s)	119
Bbv12I	GWGCWC	1 cut(s)	59
BccI	CCATC	2 cut(s)	80, 226
BmrI	ACTGGG	1 cut(s)	72
BmuI	ACTGGG	1 cut(s)	72
Bpu10I	CCTNAGC	1 cut(s)	105
Bsc4I	CCNNNNNNNGG	1 cut(s)	84
Bse1I	ACTGG	1 cut(s)	67
BseLI	CCNNNNNNNGG	1 cut(s)	84
BseNI	ACTGG	1 cut(s)	67
BsiHKAI	GWGCWC	1 cut(s)	59
BslI	CCNNNNNNNGG	1 cut(s)	84
Bsp1286I	GDGCHC	1 cut(s)	59
BsrI	ACTGG	1 cut(s)	67
BstDEI	CTNAG	1 cut(s)	105
BstNSI	RCATGY	1 cut(s)	178
BtsI	GCAGTG	1 cut(s)	95
BtsIMutI	CAGTG	1 cut(s)	95
CviAII	CATG	1 cut(s)	175
CviJI	RGCY	2 cut(s)	14, 104
CviKI_1	RGCY	2 cut(s)	14, 104
DdeI	CTNAG	1 cut(s)	105
FaeI	CATG	1 cut(s)	178
FaiI	YATR	3 cut(s)	17, 48, 176
FatI	CATG	1 cut(s)	174
Hin1II	CATG	1 cut(s)	178
HinfI	GANTC	1 cut(s)	197
HphI	GGTGA	1 cut(s)	119
HpyAV	CCTTC	4 cut(s)	4, 13, 134, 187
HpyCH4V	TGCA	1 cut(s)	50
HpyF3I	CTNAG	1 cut(s)	105
Hsp92II	CATG	1 cut(s)	178
LmnI	GCTCC	1 cut(s)	154
LpnPI	CCDG	2 cut(s)	48, 217
MfeI	CAATTG	1 cut(s)	118
MhlI	GDGCHC	1 cut(s)	59
MluCI	AATT	3 cut(s)	110, 118, 131
MunI	CAATTG	1 cut(s)	118
NlaIII	CATG	1 cut(s)	178
NspI	RCATGY	1 cut(s)	178
PfeI	GAWTC	1 cut(s)	197
SduI	GDGCHC	1 cut(s)	59
SetI	ASST	1 cut(s)	106
SgeI	CNNG	5 cut(s)	75, 110, 163, 187, 216
Sse9I	AATT	3 cut(s)	110, 118, 131
TasI	AATT	3 cut(s)	110, 118, 131
TfiI	GAWTC	1 cut(s)	197
TscAI	CASTG	1 cut(s)	95
TspDTI	ATGAA	3 cut(s)	17, 32, 176
TspGWI	ACGGA	1 cut(s)	67
TspRI	CASTG	1 cut(s)	95
XceI	RCATGY	1 cut(s)	178

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.