Rh2DG054700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
3948962 .. 3961178
12217 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG054700.1

Sequence Viewer

Length: 348 bp
ATGGCGTCACACGGGCATGGTAGCAATAACATGAGTGTATCAACCAATTCTCCGAAAAGCAGCAACGCTGCAGAAGCACCGTCGCCTAAAGGAGGAGGCCAATGCTTATGCTCACCAACAACACATCAAGGCTCATTCCGGTGCCGGTTTCATCGTTCCGGCTCCTCATCGGCTTGGACAAAGCGCCCAAAGTCCATGCCTGCAGCCAATAACTCGCCGGCTGCTCTCTCTCCCACTTCTAAGATTACAGAACCCAGGAAACAAGACTATGAAACCCACTCTCTAAATAATTACAAAAGGCAGCTATACAAATCTAGTTTAGAGGCTCAAAATACCCAACTTCCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.38

Weight (kDa)

9.96

Isoelectric Point (pI)

67.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017570)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04950
malus_domestica MD02G1048100.v1.1
prunus_persica Prupe.7G230000_v2.0.a1
pyrus_communis pycom02g04020 pycom15g16720
rosa_chinensis RchiOBHm_Chr2g0090561
rosa_roxburghii Rroxscaffold_2G00151030
rosa_rugosa Rorug02G0009100
rosa_samantha Rh2BG053600 Rh2CG055800 Rh2DG054700
rosa_wichuraiana Rw2G004750

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 141
AcyI GRCGYC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 92
AjnI CCWGG 1 cut(s) 254
AluBI AGCT 1 cut(s) 304
AluI AGCT 1 cut(s) 304
AoxI GGCC 1 cut(s) 97
ApeKI GCWGC 5 cut(s) 60, 68, 203, 221, 301
AspLEI GCGC 1 cut(s) 186
AsuHPI GGTGA 1 cut(s) 105
BanI GGYRCC 1 cut(s) 141
BbvI GCAGC 5 cut(s) 55, 72, 208, 215, 313
BciT130I CCWGG 1 cut(s) 256
BfaI CTAG 1 cut(s) 315
BfmI CTRYAG 2 cut(s) 69, 201
BfoI RGCGCY 1 cut(s) 187
BisI GCNGC 5 cut(s) 61, 69, 204, 222, 302
BlsI GCNGC 5 cut(s) 62, 70, 205, 223, 303
Bme1390I CCNGG 1 cut(s) 256
BmiI GGNNCC 2 cut(s) 143, 163
BmrFI CCNGG 1 cut(s) 256
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 254
BsaWI WCCGGW 1 cut(s) 138
BsaXI ACNNNNNCTCC 2 cut(s) 34, 64
Bsc4I CCNNNNNNNGG 1 cut(s) 92
Bse118I RCCGGY 2 cut(s) 144, 217
BseBI CCWGG 1 cut(s) 256
BseDI CCNNGG 1 cut(s) 254
BseLI CCNNNNNNNGG 1 cut(s) 92
BseRI GAGGAG 2 cut(s) 108, 154
BseXI GCAGC 5 cut(s) 55, 72, 208, 215, 313
BshFI GGCC 1 cut(s) 99
BshNI GGYRCC 1 cut(s) 141
BsiSI CCGG 4 cut(s) 139, 145, 159, 218
BslI CCNNNNNNNGG 1 cut(s) 92
BsnI GGCC 1 cut(s) 99
BspANI GGCC 1 cut(s) 99
BspLI GGNNCC 2 cut(s) 143, 163
BspMAI CTGCAG 2 cut(s) 73, 205
BspT107I GGYRCC 1 cut(s) 141
BsrFI RCCGGY 2 cut(s) 144, 217
BssAI RCCGGY 2 cut(s) 144, 217
BssECI CCNNGG 1 cut(s) 254
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 256
Bst4CI ACNGT 1 cut(s) 81
BstACI GRCGYC 1 cut(s) 5
BstC8I GCNNGC 2 cut(s) 201, 219
BstDEI CTNAG 1 cut(s) 240
BstENI CCTNNNNNAGG 1 cut(s) 90
BstH2I RGCGCY 1 cut(s) 187
BstHHI GCGC 1 cut(s) 186
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstNI CCWGG 1 cut(s) 256
BstSCI CCNGG 1 cut(s) 254
BstSFI CTRYAG 2 cut(s) 69, 201
BstV1I GCAGC 5 cut(s) 55, 72, 208, 215, 313
BsuRI GGCC 1 cut(s) 99
Cac8I GCNNGC 2 cut(s) 201, 219
CfoI GCGC 1 cut(s) 186
Cfr10I RCCGGY 2 cut(s) 144, 217
CviAII CATG 3 cut(s) 17, 31, 196
CviJI RGCY 8 cut(s) 99, 132, 162, 173, 206, 221, 304, 326
CviKI_1 RGCY 8 cut(s) 99, 132, 162, 173, 206, 221, 304, 326
DdeI CTNAG 1 cut(s) 240
EcoNI CCTNNNNNAGG 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 254
FaeI CATG 3 cut(s) 20, 34, 199
FaiI YATR 6 cut(s) 18, 32, 109, 197, 270, 307
FatI CATG 3 cut(s) 16, 30, 195
Fnu4HI GCNGC 5 cut(s) 61, 69, 204, 222, 302
Fsp4HI GCNGC 5 cut(s) 61, 69, 204, 222, 302
FspBI CTAG 1 cut(s) 315
GlaI GCGC 1 cut(s) 185
GluI GCNGC 5 cut(s) 61, 69, 204, 222, 302
HaeII RGCGCY 1 cut(s) 187
HaeIII GGCC 1 cut(s) 99
HapII CCGG 4 cut(s) 139, 145, 159, 218
HhaI GCGC 1 cut(s) 186
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 3 cut(s) 20, 34, 199
Hin6I GCGC 1 cut(s) 184
HinP1I GCGC 1 cut(s) 184
HpaII CCGG 4 cut(s) 139, 145, 159, 218
HphI GGTGA 1 cut(s) 105
Hpy188I TCNGA 1 cut(s) 54
Hpy99I CGWCG 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 81
HpyCH4V TGCA 2 cut(s) 71, 203
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 240
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 3 cut(s) 20, 34, 199
HspAI GCGC 1 cut(s) 184
KroI GCCGGC 1 cut(s) 217
KroNI GCCGGC 1 cut(s) 219
LmnI GCTCC 1 cut(s) 167
LpnPI CCDG 7 cut(s) 152, 158, 172, 213, 231, 241, 268
Lsp1109I GCAGC 5 cut(s) 55, 72, 208, 215, 313
MaeI CTAG 1 cut(s) 315
MaeIII GTNAC 1 cut(s) 6
MluCI AATT 2 cut(s) 46, 289
MnlI CCTC 4 cut(s) 86, 89, 175, 316
MroNI GCCGGC 1 cut(s) 217
MslI CAYNNNNRTG 2 cut(s) 15, 139
MspI CCGG 4 cut(s) 139, 145, 159, 218
MspR9I CCNGG 1 cut(s) 256
MvaI CCWGG 1 cut(s) 256
MwoI GCNNNNNNNGC 1 cut(s) 74
NaeI GCCGGC 1 cut(s) 219
NgoMIV GCCGGC 1 cut(s) 217
NlaIII CATG 3 cut(s) 20, 34, 199
NlaIV GGNNCC 2 cut(s) 143, 163
NmuCI GTSAC 1 cut(s) 6
PdiI GCCGGC 1 cut(s) 219
PkrI GCNGC 5 cut(s) 62, 70, 205, 223, 303
Psp6I CCWGG 1 cut(s) 254
PspGI CCWGG 1 cut(s) 254
PspN4I GGNNCC 2 cut(s) 143, 163
PstI CTGCAG 2 cut(s) 73, 205
RseI CAYNNNNRTG 2 cut(s) 15, 139
SatI GCNGC 5 cut(s) 61, 69, 204, 222, 302
ScrFI CCNGG 1 cut(s) 256
SetI ASST 1 cut(s) 306
SfcI CTRYAG 2 cut(s) 69, 201
SmiMI CAYNNNNRTG 2 cut(s) 15, 139
Sse9I AATT 2 cut(s) 46, 289
SspMI CTAG 1 cut(s) 315
StyD4I CCNGG 1 cut(s) 254
TaaI ACNGT 1 cut(s) 81
TasI AATT 2 cut(s) 46, 289
TseFI GTSAC 1 cut(s) 6
TseI GCWGC 5 cut(s) 60, 68, 203, 221, 301
Tsp45I GTSAC 1 cut(s) 6
TspDTI ATGAA 2 cut(s) 140, 285
TspGWI ACGGA 1 cut(s) 333
XagI CCTNNNNNAGG 1 cut(s) 90
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.