Rh2DG498000

The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0019305
Physical Location & Seq
Forward (+)
71827174 .. 71828153
980 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG498000.1

Sequence Viewer

Length: 372 bp
ATGGCGCAGATATCAAATGCACAACCAGATGACCTTATTGATTTCTACCATCTTAAGAGCAGAAAGGGTATGAGCCAGCTTGAGTTGGAAGATGAGGTTCAAGATGATCTCAAACGTGCTACTGGCGAGTTTGTAAAGGATGGAGATGATGCAAATAAACTCAACCGCATTCTTCAGCTCACAGGATTCAGCGATCCTGTTTATGCTGAAGCCTATGTTACAGTTAATCATTATGACATTGTTCTCGATGTTACCGTCATCAACCGAACCAAGGGAACCAAGGGAACCCTTCAGAATTTATGCTTGGAGTTGGCCACGATGGGCGATCTTAAACTTGTTGAGCATCCTCAGAACTATACACTAGCTCCATAA

Protein Analysis

123

Amino Acids

13.81

Weight (kDa)

4.68

Isoelectric Point (pI)

36.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Coatamer_beta_C PF07718 9 - 123 1.6e-38 Coatomer beta C-terminal region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019305)

Species Orthologous Gene IDs
prunus_persica Prupe.3G018100_v2.0.a1
rosa_multiflora Rmu_co8391663.1_g000001 Rmu_sc0001169.1_g000013 Rmu_sc0034979.1_g000001
rosa_samantha Rh2BG489000 Rh2BG489100 Rh2DG498000 Rh2DG498100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 166
AclWI GGATC 1 cut(s) 188
AcoI YGGCCR 1 cut(s) 312
AcsI RAATTY 1 cut(s) 295
AcuI CTGAAG 3 cut(s) 158, 228, 275
AfiI CCNNNNNNNGG 1 cut(s) 271
AflII CTTAAG 1 cut(s) 53
AgsI TTSAA 1 cut(s) 101
AjuI GAANNNNNNNTTGG 2 cut(s) 287, 319
AluBI AGCT 3 cut(s) 79, 178, 365
AluI AGCT 3 cut(s) 79, 178, 365
AlwI GGATC 1 cut(s) 188
AoxI GGCC 1 cut(s) 312
ApoI RAATTY 1 cut(s) 295
AspLEI GCGC 1 cut(s) 7
BalI TGGCCA 1 cut(s) 314
BccI CCATC 3 cut(s) 57, 134, 313
BfaI CTAG 1 cut(s) 362
BfrI CTTAAG 1 cut(s) 53
BmiI GGNNCC 2 cut(s) 277, 286
BmsI GCATC 2 cut(s) 139, 352
BpuEI CTTGAG 1 cut(s) 101
BsaJI CCNNGG 2 cut(s) 270, 279
BsaXI ACNNNNNCTCC 1 cut(s) 349
Bsc4I CCNNNNNNNGG 1 cut(s) 271
Bse1I ACTGG 1 cut(s) 127
BseDI CCNNGG 2 cut(s) 270, 279
BseGI GGATG 2 cut(s) 145, 343
BseLI CCNNNNNNNGG 1 cut(s) 271
BseMII CTCAG 1 cut(s) 362
BseNI ACTGG 1 cut(s) 127
BshFI GGCC 1 cut(s) 314
BslI CCNNNNNNNGG 1 cut(s) 271
BsmI GAATGC 1 cut(s) 168
BsnI GGCC 1 cut(s) 314
Bsp143I GATC 3 cut(s) 106, 193, 325
BspACI CCGC 1 cut(s) 166
BspANI GGCC 1 cut(s) 314
BspCNI CTCAG 1 cut(s) 361
BspLI GGNNCC 2 cut(s) 277, 286
BspPI GGATC 1 cut(s) 188
BspTI CTTAAG 1 cut(s) 53
BsrI ACTGG 1 cut(s) 127
BssECI CCNNGG 2 cut(s) 270, 279
BssMI GATC 3 cut(s) 106, 193, 325
BssT1I CCWWGG 2 cut(s) 270, 279
Bst4CI ACNGT 2 cut(s) 223, 256
BstAFI CTTAAG 1 cut(s) 53
BstC8I GCNNGC 1 cut(s) 77
BstDEI CTNAG 1 cut(s) 348
BstF5I GGATG 2 cut(s) 145, 343
BstHHI GCGC 1 cut(s) 7
BstKTI GATC 3 cut(s) 109, 196, 328
BstMBI GATC 3 cut(s) 106, 193, 325
BsuRI GGCC 1 cut(s) 314
BtsCI GGATG 2 cut(s) 145, 343
Cac8I GCNNGC 1 cut(s) 77
CfoI GCGC 1 cut(s) 7
CviJI RGCY 6 cut(s) 75, 79, 178, 212, 314, 365
CviKI_1 RGCY 6 cut(s) 75, 79, 178, 212, 314, 365
DdeI CTNAG 1 cut(s) 348
DpnI GATC 3 cut(s) 108, 195, 327
DpnII GATC 3 cut(s) 106, 193, 325
EaeI YGGCCR 1 cut(s) 312
Eco130I CCWWGG 2 cut(s) 270, 279
Eco32I GATATC 1 cut(s) 12
Eco57I CTGAAG 3 cut(s) 158, 228, 275
EcoRV GATATC 1 cut(s) 12
EcoT14I CCWWGG 2 cut(s) 270, 279
ErhI CCWWGG 2 cut(s) 270, 279
FaiI YATR 7 cut(s) 71, 204, 216, 234, 301, 357, 370
FokI GGATG 2 cut(s) 152, 330
FspBI CTAG 1 cut(s) 362
GlaI GCGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 314
HhaI GCGC 1 cut(s) 7
Hin6I GCGC 1 cut(s) 5
HinP1I GCGC 1 cut(s) 5
HinfI GANTC 1 cut(s) 186
Hpy188I TCNGA 2 cut(s) 294, 351
Hpy188III TCNNGA 2 cut(s) 101, 245
HpyAV CCTTC 1 cut(s) 299
HpyCH4III ACNGT 2 cut(s) 223, 256
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 2 cut(s) 20, 152
HpyF3I CTNAG 1 cut(s) 348
HpySE526I ACGT 1 cut(s) 115
HspAI GCGC 1 cut(s) 5
Kzo9I GATC 3 cut(s) 106, 193, 325
LmnI GCTCC 1 cut(s) 370
LpnPI CCDG 5 cut(s) 39, 89, 108, 168, 210
LweI GCATC 2 cut(s) 139, 352
MaeI CTAG 1 cut(s) 362
MaeII ACGT 1 cut(s) 115
MaeIII GTNAC 2 cut(s) 217, 250
MalI GATC 3 cut(s) 108, 195, 327
MboI GATC 3 cut(s) 106, 193, 325
MboII GAAGA 2 cut(s) 101, 164
MlsI TGGCCA 1 cut(s) 314
MluCI AATT 1 cut(s) 295
MluNI TGGCCA 1 cut(s) 314
MmeI TCCRAC 1 cut(s) 66
MnlI CCTC 2 cut(s) 88, 357
Mox20I TGGCCA 1 cut(s) 314
MscI TGGCCA 1 cut(s) 314
MseI TTAA 3 cut(s) 54, 225, 330
Msp20I TGGCCA 1 cut(s) 314
MspCI CTTAAG 1 cut(s) 53
Mva1269I GAATGC 1 cut(s) 168
NdeII GATC 3 cut(s) 106, 193, 325
NlaIV GGNNCC 2 cut(s) 277, 286
PcsI WCGNNNNNNNCGW 1 cut(s) 252
PctI GAATGC 1 cut(s) 168
PfeI GAWTC 1 cut(s) 186
PspN4I GGNNCC 2 cut(s) 277, 286
SaqAI TTAA 3 cut(s) 54, 225, 330
Sau3AI GATC 3 cut(s) 106, 193, 325
SetI ASST 6 cut(s) 36, 81, 99, 118, 180, 367
SfaNI GCATC 2 cut(s) 139, 352
SmlI CTYRAG 2 cut(s) 53, 80
SmoI CTYRAG 2 cut(s) 53, 80
Sse9I AATT 1 cut(s) 295
SsiI CCGC 1 cut(s) 166
SspMI CTAG 1 cut(s) 362
StyI CCWWGG 2 cut(s) 270, 279
TaaI ACNGT 2 cut(s) 223, 256
TaiI ACGT 1 cut(s) 118
TaqI TCGA 1 cut(s) 246
TasI AATT 1 cut(s) 295
TfiI GAWTC 1 cut(s) 186
Tru1I TTAA 3 cut(s) 54, 225, 330
Tru9I TTAA 3 cut(s) 54, 225, 330
Vha464I CTTAAG 1 cut(s) 53
XapI RAATTY 1 cut(s) 295
XspI CTAG 1 cut(s) 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.