Rh3AG183400

BTB POZ domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
17336565 .. 17337208
644 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG183400.1

Sequence Viewer

Length: 342 bp
ATGACAACTAAAGGGGTTTCTTTTCTTCTTGACTGTAAAGCTCTTGAAGATCCCTTGCTGCGTCATAATGGTCCTGGGATAAAGAGAAGCTTTATTTCCGATGCTGCTTCAAAGTTGCCACTGCTTAGGAAGGTATCATTAGATTTGTGTGATGCAAGTGAAGGTGAATTTGATATTCCTGATTATGCTGACATATATTTTCTAAGTACTGTGAAGATCGCTAGATGTAAGTCTCAGAGGTATGGTCTGGAGGTTCAGTTTGTCGAGGCTCGTAGGAGGCCTGTGCACAAAGAAACCTTGTGCTGGTGTGGAACAGCAAAACTATCATTAGAACAGTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.81

Weight (kDa)

8.3

Isoelectric Point (pI)

42.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 44
AcsI RAATTY 1 cut(s) 167
AfaI GTAC 1 cut(s) 208
AfiI CCNNNNNNNGG 1 cut(s) 303
AgsI TTSAA 2 cut(s) 47, 111
AjnI CCWGG 1 cut(s) 73
AluBI AGCT 2 cut(s) 41, 90
AluI AGCT 2 cut(s) 41, 90
Alw21I GWGCWC 1 cut(s) 288
Alw26I GTCTC 1 cut(s) 237
Alw44I GTGCAC 1 cut(s) 284
AlwI GGATC 1 cut(s) 44
AoxI GGCC 1 cut(s) 278
ApaLI GTGCAC 1 cut(s) 284
ApeKI GCWGC 2 cut(s) 58, 104
ApoI RAATTY 1 cut(s) 167
AspS9I GGNCC 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 176
AvaII GGWCC 1 cut(s) 71
BaeGI GKGCMC 1 cut(s) 288
Bbv12I GWGCWC 1 cut(s) 288
BbvI GCAGC 2 cut(s) 45, 91
BciT130I CCWGG 1 cut(s) 75
BcoDI GTCTC 1 cut(s) 237
BfaI CTAG 1 cut(s) 222
BisI GCNGC 2 cut(s) 59, 105
BlsI GCNGC 2 cut(s) 60, 106
BmcAI AGTACT 1 cut(s) 208
Bme1390I CCNGG 1 cut(s) 75
Bme18I GGWCC 1 cut(s) 71
BmgT120I GGNCC 1 cut(s) 71
BmrFI CCNGG 1 cut(s) 75
BmsI GCATC 2 cut(s) 91, 142
BpmI CTGGAG 1 cut(s) 269
Bpu10I CCTNAGC 1 cut(s) 125
BsaJI CCNNGG 1 cut(s) 74
BsaXI ACNNNNNCTCC 2 cut(s) 242, 272
Bsc4I CCNNNNNNNGG 1 cut(s) 303
BseBI CCWGG 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 303
BseMII CTCAG 1 cut(s) 248
BseSI GKGCMC 1 cut(s) 288
BseXI GCAGC 2 cut(s) 45, 91
BshFI GGCC 1 cut(s) 280
BsiHKAI GWGCWC 1 cut(s) 288
BslI CCNNNNNNNGG 1 cut(s) 303
BsmAI GTCTC 1 cut(s) 237
BsnI GGCC 1 cut(s) 280
Bsp1286I GDGCHC 1 cut(s) 288
Bsp143I GATC 2 cut(s) 49, 216
BspANI GGCC 1 cut(s) 280
BspCNI CTCAG 1 cut(s) 247
BspPI GGATC 1 cut(s) 44
BssECI CCNNGG 1 cut(s) 74
BssMI GATC 2 cut(s) 49, 216
Bst2UI CCWGG 1 cut(s) 75
Bst4CI ACNGT 3 cut(s) 35, 211, 336
BstDEI CTNAG 3 cut(s) 125, 203, 234
BstKTI GATC 2 cut(s) 52, 219
BstMAI GTCTC 1 cut(s) 237
BstMBI GATC 2 cut(s) 49, 216
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 73
BstSLI GKGCMC 1 cut(s) 288
BstV1I GCAGC 2 cut(s) 45, 91
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BsuRI GGCC 1 cut(s) 280
BtsI GCAGTG 1 cut(s) 119
BtsIMutI CAGTG 2 cut(s) 119, 341
Cfr13I GGNCC 1 cut(s) 71
CseI GACGC 1 cut(s) 50
Csp6I GTAC 1 cut(s) 207
CviJI RGCY 4 cut(s) 41, 90, 269, 280
CviKI_1 RGCY 4 cut(s) 41, 90, 269, 280
CviQI GTAC 1 cut(s) 207
DdeI CTNAG 3 cut(s) 125, 203, 234
DpnI GATC 2 cut(s) 51, 218
DpnII GATC 2 cut(s) 49, 216
Eco147I AGGCCT 1 cut(s) 280
Eco47I GGWCC 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 73
FaiI YATR 5 cut(s) 66, 186, 194, 196, 243
FalI AAGNNNNNCTT 2 cut(s) 74, 106
Fnu4HI GCNGC 2 cut(s) 59, 105
Fsp4HI GCNGC 2 cut(s) 59, 105
FspBI CTAG 1 cut(s) 222
GluI GCNGC 2 cut(s) 59, 105
GsuI CTGGAG 1 cut(s) 269
HaeIII GGCC 1 cut(s) 280
HgaI GACGC 1 cut(s) 50
HindIII AAGCTT 1 cut(s) 88
HphI GGTGA 1 cut(s) 176
Hpy166II GTNNAC 1 cut(s) 286
Hpy188I TCNGA 2 cut(s) 100, 237
Hpy188III TCNNGA 4 cut(s) 29, 44, 179, 248
Hpy8I GTNNAC 1 cut(s) 286
HpyAV CCTTC 2 cut(s) 124, 155
HpyCH4III ACNGT 3 cut(s) 35, 211, 336
HpyCH4V TGCA 2 cut(s) 155, 286
HpyF3I CTNAG 3 cut(s) 125, 203, 234
Kzo9I GATC 2 cut(s) 49, 216
LpnPI CCDG 6 cut(s) 60, 87, 192, 233, 289, 294
Lsp1109I GCAGC 2 cut(s) 45, 91
LweI GCATC 2 cut(s) 91, 142
MaeI CTAG 1 cut(s) 222
MalI GATC 2 cut(s) 51, 218
MboI GATC 2 cut(s) 49, 216
MboII GAAGA 3 cut(s) 17, 59, 226
MflI RGATCY 1 cut(s) 49
MhlI GDGCHC 1 cut(s) 288
MluCI AATT 1 cut(s) 167
MnlI CCTC 4 cut(s) 231, 244, 259, 270
MspR9I CCNGG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 75
NdeII GATC 2 cut(s) 49, 216
PceI AGGCCT 1 cut(s) 280
PkrI GCNGC 2 cut(s) 60, 106
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
PspPI GGNCC 1 cut(s) 71
PsuI RGATCY 1 cut(s) 49
RsaI GTAC 1 cut(s) 208
RsaNI GTAC 1 cut(s) 207
SatI GCNGC 2 cut(s) 59, 105
Sau3AI GATC 2 cut(s) 49, 216
Sau96I GGNCC 1 cut(s) 71
ScaI AGTACT 1 cut(s) 208
ScrFI CCNGG 1 cut(s) 75
SduI GDGCHC 1 cut(s) 288
SetI ASST 7 cut(s) 43, 92, 135, 166, 242, 255, 299
SfaNI GCATC 2 cut(s) 91, 142
SinI GGWCC 1 cut(s) 71
Sse9I AATT 1 cut(s) 167
SseBI AGGCCT 1 cut(s) 280
SspMI CTAG 1 cut(s) 222
StuI AGGCCT 1 cut(s) 280
StyD4I CCNGG 1 cut(s) 73
TaaI ACNGT 3 cut(s) 35, 211, 336
TaqI TCGA 1 cut(s) 264
TasI AATT 1 cut(s) 167
TatI WGTACW 1 cut(s) 206
TscAI CASTG 2 cut(s) 126, 341
TseI GCWGC 2 cut(s) 58, 104
TspRI CASTG 2 cut(s) 126, 341
VneI GTGCAC 1 cut(s) 284
VpaK11BI GGWCC 1 cut(s) 71
XapI RAATTY 1 cut(s) 167
XspI CTAG 1 cut(s) 222
ZrmI AGTACT 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.